active control over secondary instability in a swept wing boundary layer
Volatile Organic Compound Concentrations and Emission Rates Measured over One Year in a New Manufactured House pptx
Ngày tải lên :
22/03/2014, 14:20
... weekly, and the valves were adjusted as required to maintain constant rates The sampling and analytical process was computer controlled TVOC was determined as the sum of all chromatographic peaks in ... the HAC fan was operated continuously with the outdoor air intake sealed, and the indoor temperature was maintained by thermostatic control of the heating or air conditioning equipment Air samples ... with age and in the house parameters, principally air change rate, temperature and relative humidity Air change rates in the house, which was operated at a single defined condition for all the sampling...
- 34
- 600
- 0
Báo cáo hóa học: " “Hypoxia-induced down-regulation of microRNA449a/b impairs control over targeted SERPINE1 (PAI-1) mRNA - a mechanism involved in SERPINE1 (PAI-1) overexpression” pptx
Ngày tải lên :
18/06/2014, 16:20
... hypoxia, at least in certain areas, which affects miRNA-449 and SERPINE1 expression Indeed, an inverse expression of miRNA-44 9a/ b and SERPINE1 mRNA expression could be demonstrated in almost all patient ... scattered inflammatory cells inflammation was not the predominant feature in our samples Regulation of the SERPINE1 molecule is mainly achieved at the transcriptional level and the gene contains ... Zhuang Z, Campo E, Rozhin J, Sloane BF, Liotta LA: Stetler-Stevenson WG Increased gelatinase A (MMP-2) and cathepsin B activity in invasive tumor regions of human colon cancer samples Am J Pathol...
- 14
- 279
- 0
Báo cáo sinh học: "Hypoxia-induced down-regulation of microRNA449a/b impairs control over targeted SERPINE1 (PAI-1) mRNA - a mechanism involved in SERPINE1 (PAI-1) overexpression" pptx
Ngày tải lên :
18/06/2014, 19:20
... or misleading interpretation we may have caused Additional material Additional file 1: Data underlying corrected Figures 2, 4, 5, Authors’ Note Katharina Theophile, the 2nd author in the author ... expression by incorporating a dotted line The line was intended to highlight the additional increase of SERPINE1 (PAI-1) mRNA by miRNA-44 9a/ b inhibitors Unfortunately, it could also suggest a false-positive ... miRNA-44 9a/ b inhibitors additionally increased the hypoxia-induced SERPINE1 mRNA expression The mean, minimum and maximum of calculations relative to reference gene POLR 2A compared with non-transfected...
- 5
- 222
- 0
báo cáo hóa học:" Hypoxia-induced down-regulation of microRNA449a/b impairs control over targeted SERPINE1 (PAI-1) mRNA - a mechanism involved in SERPINE1 (PAI-1) overexpression" pdf
Ngày tải lên :
20/06/2014, 03:20
... or misleading interpretation we may have caused Additional material Additional file 1: Data underlying corrected Figures 2, 4, 5, Authors’ Note Katharina Theophile, the 2nd author in the author ... expression by incorporating a dotted line The line was intended to highlight the additional increase of SERPINE1 (PAI-1) mRNA by miRNA-44 9a/ b inhibitors Unfortunately, it could also suggest a false-positive ... miRNA-44 9a/ b inhibitors additionally increased the hypoxia-induced SERPINE1 mRNA expression The mean, minimum and maximum of calculations relative to reference gene POLR 2A compared with non-transfected...
- 5
- 215
- 0
báo cáo khoa học: "Gene-expression and network-based analysis reveals a novel role for hsa-mir-9 and drug control over the p38 network in Glioblastoma Multiforme progression" ppsx
Ngày tải lên :
11/08/2014, 12:21
... each pathway in the database) to each sample in every dataset Network information has been obtained from The National Cancer Institute's Pathway Interaction Database (PID) [12] We then iterated ... name Target Pathway Accutane RARA Map kinase inactivation of smrt co-repressor CCNU STMN4 Signaling mediated by p38-gamma and p38-delta pathway Celebrex COX2 Signaling mediated by p38-alpha and ... p38-beta pathway Cis Retinoic Acid RARA Map kinase inactivation of smrt co-repressor Sorafenib RAF1 p38 signaling mediated by MAPKAP kinases Tamoxifen ESR1 Signaling mediated by p38-alpha and p38-beta...
- 26
- 278
- 0
Báo cáo y học: "Strict glycaemic control in patients hospitalised in a mixed medical and surgical intensive care unit: a randomised clinical trial"
Ngày tải lên :
25/10/2012, 10:35
... peak plasma creatinine > 2.5 mg/dl, Peak plasma urea nitrogen > 60 mg/dl, dialysis or continuous venovenous haemofiltration Table Causes of mortality in the patient group Variable Standard treatment ... AR, AQ and LG participated in study conception, study design, data acquisition, data analysis and interpretation, and drafting of the manuscript, NS, MB, JT, JV, JV, CA, PA, EV, JCH, AY, WP and ... was given to 14 patients in the standard insulin group (5.6%) and 14 in the intensive insulin group (5.5%) The remaining patients received total-enteral feeding exclusively In the standard insulin...
- 9
- 635
- 0
Báo cáo y học: "Comparative study of control selection in a national population -based case-control study: Estimating risk of smoking on cancer deaths in Chinese men"
Ngày tải lên :
26/10/2012, 09:48
... design and a routine control selection design in a large case -control study that was incorporated into a nationwide mortality survey in China in 1989–1991 As an example, we assessed the hazards ... given indication Our findings revealed that better equivalence exists in urban than in rural areas, and for cancers with a high death rate than for ‘rare’ cancers The possible explanations may be: ... has been raised simultaneously, is it accurate and validation? Although most clinical study activities are aimed at showing that equivalence can also be claimed for generic versions of innovator...
- 9
- 532
- 1
Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge
Ngày tải lên :
05/09/2013, 10:15
... SVI gradually decreased due to aerobic granulation, as shown in Figs and As sludge settling ability increased, surface loading and aeration rates were gradually increased, and finally set at 1.8 ... aeration rates Formation of Aerobic Granular Sludge by Controlling Surface Loading and Aeration Rates Surface loading and aeration rates were initially set at 1.2 m3/m2/d and 0.30 L/min, respectively, ... known as an important factor influencing the sludge selection in an SBR (McSwain et al., 200 4a) Generally, surface loading rate (equal to liquid linear velocity at a sludge settling zone) and aeration...
- 8
- 481
- 0
Displaying an Image from a Database in a Web Forms Control
Ngày tải lên :
28/10/2013, 18:15
... containing the image from the database Create a SQL statement to retrieve the required image from the database and retrieve the image using a DataReader A DataTable or DataSet filled using a DataAdapter ... image from the database and serves it to the Image control on the web page that the client sees The following steps outline the required tasks: Create a web page that outputs a binary stream ... the image as a binary stream The BinaryWrite( ) method of the HttpResponse object writes a stream of binary characters to the HTTP output stream rather than a textual stream Response.BinaryWrite((byte[])dr["Photo"]);...
- 3
- 442
- 0
Displaying an Image from a Database in a Windows Forms Control
Ngày tải lên :
28/10/2013, 18:15
... that are bound to the same data source so that they display information from the object within the data source, such as a row in a DataTable The BindingContext class is used to instantiate a BindingManagerBase ... CurrencyManager notifies all data-bound controls if the current item changes so that they can refresh their data The PropertyManager class inherits from the BindingManagerBase class and maintains ... private BindingManagerBase bm; // private void DisplayDatabaseImageForm_Load(object sender, System.EventArgs e) { // Create the DataSet ds = new DataSet( ); // Create the DataAdapter and retrieve...
- 5
- 391
- 0
PLC communications in a process control system
Ngày tải lên :
25/12/2013, 08:50
... than one bit per baud Baseband and broadband The principle characteristics of base-band and broadband systems are listed in Table BASEBAND Digital signalling Entire bandwidth consumed By signal ... 56 interfaces A ninth user is an additional lines and 16 interfaces This is clearly very expensive in hardware and installation 1 (a) Point-to-point topology 1(b) mesh topology Figure 1 (a) Point-to-point ... non-standard interface cards using the transmission protocols of other PLC manufacturers COMMUNICATION Interface standards Over the course of time certain interfacing standards have been generated...
- 10
- 394
- 1
Tài liệu PLC Communications in a Process Control System docx
Ngày tải lên :
25/01/2014, 05:20
... than one bit per baud Baseband and broadband The principle characteristics of base-band and broadband systems are listed in Table BASEBAND Digital signalling Entire bandwidth consumed By signal ... non-standard interface cards using the transmission protocols of other PLC manufacturers COMMUNICATION Interface standards Over the course of time certain interfacing standards have been generated ... the fact that most PCs, which are used more and more in automation systems today, have at least one PS232 (serial) interface as a standard RS232, however, has some limitations Distance, a maximum...
- 8
- 472
- 1
Tài liệu Clinical presentation and outcome of patients diagnosed with active pulmonary tuberculosis in a large critical care unit docx
Ngày tải lên :
15/02/2014, 12:20
... categories are shown as means with ranges where appropriate Comparative data between characteristics are displayed, and data are summarized as tables as well as in text Results Patient characteristics ... awareness King Fahad National Guard Hospital is an 800-bed tertiary care hospital located in the central region of the Kingdom of Saudi Arabia (KSA), provides multilevel health care for National Guard ... mechanical ventilation It is probable that debilitating factors such as alcoholism or anemia are contributory Aspiration of sputum leading to aspiration pneumonia was a less common diagnosis in...
- 6
- 506
- 0
Overcoming Secondary Stress in Medical and Nursing Practice: A Guide to Professional Resilience and Personal Well-Being docx
Ngày tải lên :
06/03/2014, 13:20
... maintaining and increasing the passion one originally had for being a professional in the healing arts Everything that initially attracted people to this fascinating, meaningful, and rewarding ... Hahnemann Medical College, a physician who had one of the busiest practices in the area came in for an initial psychological assessment He was having an affair outside of his marriage Being a ... clinicians aware of the challenges of being a physician today are Wayne and Mary Sotile.They have 20 Overcoming Secondary Stress in Medical and Nursing Practice Table 1-1 Causes of Burnout Inadequate...
- 214
- 549
- 0
How to attract interests and involvement of the 9th graders in a speaking lessons at Minh Thanh secondary in Quang Ninh
Ngày tải lên :
15/03/2014, 10:03
... English teaching and learning in general and a speaking lesson in particular To get more information about the situation of teaching speaking skill in 9th form classes in Minh Thanh secondary school ... attractive than the others because it attracts a lot of participants in a class and makes a class more interesting” a student said Playing games gives students relaxing times and way to understand ... conversations In fact, speaking activities in a traditional classroom often take place, in the way of one person asking a question and another giving an answer As a result, the questions and the answers...
- 119
- 525
- 1
Báo cáo khoa học: E2A participates in a fine control of pre-mature B-cell apoptosis mediated by B-cell receptor signaling via transcriptional regulation of survivin, IAP2 and caspase-8 genes pot
Ngày tải lên :
16/03/2014, 04:20
... (squares, triangles and diamonds) at indicated times up to 16 h, and then caspase activity assays were performed using appropriate caspase assay kits Absorbance at 405 nm was measured to determine ... survivin and IAP2 accompanied by unchanged gene expression of caspase-8 (and also various B cell-specific factors, HDACs, HATs, apoptosis-related factors, caspases, caspase-regulating factors and CAD/ICAD) ... thereafter decreased dramatically by 24 h Expression of caspase-3 and caspase-9 remained unchanged in the presence of PMA/ionomycin Interestingly, in DT40, PMA/ionomycin treatment increased the caspase-8...
- 11
- 349
- 0
Báo cáo khoa học: Role of active-site residues of dispersin B, a biofilm-releasing b-hexosaminidase from a periodontal pathogen, in substrate hydrolysis pptx
Ngày tải lên :
16/03/2014, 06:20
... GGTGGCGATCAATTTGGTTATTCTGTGG CCACAGAATAACCAAATTGATCGCCACC GATGAATTTGGTGCGTCTGTGGAAAG CTTTCCACAGACGCACCAAATTCATC CCGAATATTGAAATTACTTATGCGAGCTATGATGGCG CGCCATCATAGCTCGCATAAGTAATTTCAATATTCGG CCTATTATCTTGCGATTGTTCCGAAAGC ... CTGGACATCGCCGCGCATTTTTATTCAC GTGAATAAAAATGCGCGGCGATGTCCAG GCTGGACATCGCCAAACATTTTTATTCACCCG CGGGTGAATAAAAATGTTTGGCGATGTCCAGC GGTGGCAACGAATTTGGTTATTCTGTGG CCACAGAATAACCAAATTCGTTGCCACC GGTGGCGATCAATTTGGTTATTCTGTGG ... CCTATTATCTTGCGATTGTTCCGAAAGC GCTTTCGGAACAATCGCAAGATAATAGG GCAGCATTATCGATCTACGGAGAAGATGC GCATCTTCTCCGTAGATCGATAATGCTGC CATTATCGATCTGGGGACAAGATGCAAAAGC GCTTTTGCATCTTGTCCCCAGATCGATAATG Forward Reverse Forward Reverse...
- 13
- 311
- 0
Báo cáo khoa học: Schemes of flux control in a model of Saccharomyces cerevisiae glycolysis docx
Ngày tải lên :
17/03/2014, 11:20
... and over a much wider range of operation than that for which the model was originally intended It has been suggested [17] that inductive, multivariate and machine learning approaches are appropriate ... model for parameter scanning using routines contained in GEPASI METHODS Model A model of branched glycolysis, as described in [7] was obtained in SCAMP format from one of its authors (a kind gift ... performed as described in [22,23] and using tables therein Principal components analysis (PCA) [24–26] was performed using HOBBES, an in- house multivariate statistics package [27,28] Parameter fitting...
- 11
- 530
- 0
A study on technique to improve speaking skill for secondary student in Quang Ninh.
Ngày tải lên :
19/03/2014, 17:07
... pronouncing words There are three kinds of speaking situations in which we find ourselves: Interactive, Partially interactive, and Non-interactive Interactive speaking situations include face-to-face ... vocabulary because these areas are tested in examinations This means that speaking is a neglected language skill in many classrooms Students may have a good knowledge of grammar and a wide vocabulary: ... THEORETICAL BACKGROUND I Understanding speaking skill I.1 What is speaking? Speaking is an interactive process of constructing meaning that involves producing and receiving and process information...
- 73
- 1.6K
- 14