acd as a defense strategy of the body
Báo cáo khoa học: Interaction of the general transcription factor TnrA with the PII-like protein GlnK and glutamine synthetase in Bacillus subtilis potx
... TnrAN (5¢-GCT CGA GGA TCC GAT GAC CAC AGA AGA TCA TTC TT-3¢) and TnrA6 (5¢-TTA ACG GGA TCC GTA CCG TTA GTG AGC ATT AAG3¢) The PCR products were purified, digested with BamHI, and ligated into the ... more clearly, ATP was titrated to the binding assays in the absence or presence of 2-oxolguatarate As shown in Fig 3A, 0.2 mm ATP was sufficient to inhibit 50% of the GlnK–TnrA interaction The inhibitory ... TnrA (TnrAwt), TnrA6, TnrA20, and TnrA35 The analyte (40 nM GlnK or GS oligomers) was injected in a volume of 30 lL onto the TnrA surface at a flow rate of 15 lLÆmin)1 His6-NAGK served as a control...
- 11
- 596
- 0
Báo cáo khoa học: Crystal structure of basic 7S globulin, a xyloglucanspecific endo-b-1,4-glucanase inhibitor protein-like protein from soybean lacking inhibitory activity against endo-b-glucanase doc
... DASA in dimer formation The DASA of the AB dimer is defined as [(ASA of A) + (ASA of B) ) (ASA of AB dimer)] ⁄ The number of water molecules in the dimer interface was detected with ASV CALCULATOR ... was calculated (Table 1) It is conceivable that a dimer with larger DASA is more plausible We found that the DASAs of the AB and DA dimers were comparable Although the DASA of the CD dimer was ... fungal xyloglucan-specific endo-b-1,4-glucanase (XEG), an enzyme classified as a member of the glycoside hydrolase (GH)12 family in the CAZy database [2] (http://www.cazy.org) Tomato XEGIP is a basic...
- 11
- 524
- 0
Báo cáo khoa học: A (1fi3)-b-D-glucan recognition protein from the sponge Suberites domuncula Mediated activation of fibrinogen-like protein and epidermal growth factor gene expression pot
... from the Diptera Anopheles gambiae (ENSAN1_ANGA, XP_312118.1), (ENSAN5_ANGA, XP_312116.1) and (BACBP_ANGA, CAA04496.1), as well as the GLUBP from the lobster Homarus gammarus (GLUBP_HOGAM, CAE47485.1) ... mosquito Anopheles gambiae to bacteria and malaria parasites Proc Natl Acad Sci USA 94, 11508–11513 19 Bachman, E.S & McClay, D.R (1996) Molecular cloning of the first metazoan beta-1,3 glucanase from ... Recombinant EGF precursor and production of antibodies The sponge SDEGFI-PREC sequence was isolated by PCR using the forward primer, f1 [5¢-CCATGGAGA AGATTCTAGCAACAGTCAATTCAAATGAC-3¢ (the NcoI...
- 14
- 299
- 0
Báo cáo khoa học: The ubiquitin-like protein monoclonal nonspecific suppressor factor b conjugates to endophilin II and regulates phagocytosis potx
... (Chatsworth, CA, USA) The target sequences were as follows: MNSFb siRNA-437, 5¢-CCACCCTGCCATGCTAATAAA-3¢ [3]; and endophilin II siRNA, 5¢-AAGGTGCTCTAGAAACACTAA-3¢ Scramble siRNA directed against ... conjugates to endophilin II M Nakamura and S Shimosaki mitogen-activated protein kinase (MAP kinase) pathway by inhibiting the activation of extracellular signalregulated kinase (ERK) [3] Several ... or antibody against endophilin II A rabbit IgG TrueBlot was employed as a second antibody Cell culture, the siRNAs, and transfection of cells Cells of the Raw264.7 macrophage-like cell line (ATCC...
- 9
- 359
- 0
Báo cáo y học: "Intrathecal siRNA against Toll-like receptor 4 reduces nociception in a rat model of neuropathic pain"
... cDNA sequence of rat TLR4 (GenBank accession NM_019178) were: 5’-CUACCAACAGAGAGGAUAU-3” (siRNA1), 5’-GUCUCAGAUAUCUAGAUCU-3’ (siRNA2), 5’-GAGCCGGAAAGUUAUUGUG-3’ (siRNA3) All siRNAs were chemically ... USA) was administered intrathecally once daily for days, starting from day before CCI surgery Evaluation of tactile allodynia and thermal hyperalgesia The paw withdrawal latency (PWL) to radiant ... with a transparent plastic dome, and allowed to acclimate for 30 minutes before testing The filament was applied perpendicularly to the plantar surface of the hind paw (ipsilateral to the side of...
- 9
- 487
- 0
Tài liệu Báo cáo khoa học: Crystal structure of importin-a bound to a peptide bearing the nuclear localisation signal from chloride intracellular channel protein 4 ppt
... (excluding water molecules and peptide atoms) and rj is the standard deviation of B factors The normalized B factors have a zero mean and unit variance All atoms that satisfy Bz ‡ are treated as outliers ... refinement After datasets had been initially processed and integrated in mosflm, the reflection data file was then passed through a suite of programs in the ccp4 crystallography package [36] Scaling of ... peptide B factor analysis In order to analyse changes in the conformational dynamics of importin -a residues, a comparison was made between the atomic B factors of apo importin -a and the importina:CLIC4...
- 14
- 741
- 0
Tài liệu Báo cáo khoa học: Angiopoietin-like proteins: emerging targets for treatment of obesity and related metabolic diseases pptx
... cardiovascular disease in an autocrine or paracrine manner Blocking ANGPTL2 signaling may also be beneficial also in preventing and treating cardiovascular disease (Fig 1) To date, integrins have ... that ANGPTL2 promotes vascular inflammation rather than angiogenesis in these tissues, although it has been shown to enhance endothelial cell migration in vitro and in avascular tissues, such as ... as a therapeutic strategy is more beneficial Because ANGPTL2 promotes vascular inflammation via the a5 b1 integrin ⁄ Rac1 ⁄ NF-jB pathway [15] and vascular injury accompanied by inflammation is considered...
- 6
- 609
- 0
Tài liệu Báo cáo khoa học: Mitochondrial chaperone tumour necrosis factor receptor-associated protein 1 protects cardiomyocytes from hypoxic injury by regulating mitochondrial permeability transition pore opening docx
... silencing of TRAP1 expression (TRAP1-siRNA) was purchased from Shanghai GeneChem, Co Ltd The targeting sequence of the siRNA against rat TRAP1 was 5¢-CAACAGAGATTGATCAA AT-3¢ A negative control adenovirus ... cardiomyocytes, the role of that TRAP1 increase remains unclear The question remains as to whether the hypoxia-induced TRAP1 increase is a protective reaction in cardiomyocytes Because TRAP1 is a mitochondrial ... substrates (i.e cytochrome c) are released into the cytoplasm and activate caspase-dependent apoptotic pathways Because MPTP plays a critical role in cell necrosis and apoptosis, it is also involved...
- 10
- 507
- 0
Báo cáo khoa học: Human lactoferrin activates NF-jB through the Toll-like receptor 4 pathway while it interferes with the lipopolysaccharide-stimulated TLR4 signaling potx
... T Hiraga, K Ihashi, K Sato, N Komagata, H Majima, Y Namekawa, A Suzuki, A Kashimura, M Yamamuro, M Watanabe, K Ito, Y Murase and T Setoguchi for technical assistance We also thank Dr S Miyamoto ... contrast, when hLF was treated with endo-b-galactosidase, which is known to cleave the carbohydrate chains at the internal Galb1-4GlcNAc position, IKK activation and nuclear translocation of RelA ... obtained from Cell Signaling Technology (Danvers, MA, USA) The TNF -a Human Biotrak Easy ELISA kit was obtained from GE Healthcare BioSciences KK, Japan Actinase E was obtained from KakenSeiyaku...
- 16
- 456
- 0
Báo cáo khoa học: A unique vertebrate histone H1-related protamine-like protein results in an unusual sperm chromatin organization pot
... barbatus were collected from different locations along the Mediterranean Sea during the spawning season The extent of gonadal maturity was microscopically assessed, and mature sperm was obtained ... centrifuged as before to produce a supernatant SII and a pellet PII The A2 60 of the SI and SII fractions was measured, and the amount of DNA present in the samples was determined using an extinction ... (Brinkmann) The A2 60 of the supernatant was used to determine the percentage of PCA-soluble DNA [36] The second aliquot was added to tubes containing excess EDTA (so that the final EDTA concentration...
- 14
- 484
- 0
Báo cáo Y học: Crystal structure of the catalytic domain of a human thioredoxin-like protein pdf
... Murakawa, M., Takahashi, S., Tsubuki, S., Kawashima, S., Sakamaki, K & Yonehara, S (1998) Purification, molecular cloning, and characterization of TRP32, a novel thioredoxin-related mammalian ... 1ERT) as a search model, then refined smoothly in alternating steps of automatic adjustment with CNS and manual adjustment with the program O [34] The final model has a final R-factor of 0.222 with a ... hTRXL-N may account for the formation of a monomer, instead of a dimer in the case of TRX Furthermore, the loss of intermolecular disulfide-bonds and the disbandment of the hydrophobic patch may also...
- 9
- 533
- 0
Báo cáo Y học: A novel DNA repair enzyme containing RNA recognition, G-patch and specific splicing factor 45-like motifs in the protozoan parasite Toxoplasma gondii potx
... in human malaria parasites is predominantly by a long-patch pathway Biochemistry 39, 763–772 Haltiwanger, B.M., Karpinich, N.O & Taraschi, T.F (2000) Characterization of class II apurinic/apyrimidinic ... Toxoplasma gondii Mol Biochem Parasitol 99, 223–235 Pang, Q., Hays, J.B & Rajagopal, I (1993) Two cDNAs from the plant Arabidopsis thaliana that partially restore recombination proficiency and DNA-damage ... from the related apicomplexa parasites, Plasmodium falciparum and Plasmodium yoelii (Fig 5) No similarity with other known DNA repair enzymes could be found in the databases, suggesting that these...
- 9
- 421
- 0
Báo cáo khoa học: A role of monocyte chemoattractant protein-4 (MCP-4)/CCL13 from chondrocytes in rheumatoid arthritis doc
... (1989) The effect of tumor necrosis factor alpha and gamma-interferon on the resorption of human articular cartilage and on the production of prostaglandin E and of caseinase activity by human articular ... new target for anti-RA therapy Experimental procedures Preparation of articular cartilage and synovial tissue Human articular cartilage and synovial tissue were obtained from OA and RA patients ... that are dependent on the activation of ERK MAP kinase These data suggest that MCP-4 ⁄ CCL13 is a significant contributor to synovial hyperplasia in RA, and that MCP-4 ⁄ CCL13 may serve as a new...
- 9
- 386
- 0
Báo cáo khoa học: Brox, a novel farnesylated Bro1 domain-containing protein that associates with charged multivesicular body protein 4 (CHMP4) potx
... has a point mutation at amino acid 408, was created by PCR-based site-directed mutagenesis using pmGFP–Brox as a template and complementary primers (5¢-CAA AAG GAC ACT GGG TCC TAC ATC TCC TAA ... Peroxidase-conjugated goat anti-rabbit IgG and goat anti-mouse IgG were obtained from Wako (Osaka, Japan) Preparation of rabbit pAbs against Alix has been described previously [40] Cy3-labeled anti-mouse ... AAT TCA TGA CCC ATT GGT TTC ATA GGA ACC-3¢ and 5¢-GGG AAT TCT TAG GAG ATG TAG CAC CCA GTG TC-3¢ (nucleotides corresponding to a cDNA of the hypothetical protein C1orf58 are underlined), and an...
- 11
- 412
- 0
Báo cáo khoa học: Analysis of the regulatory motifs in eukaryotic initiation factor 4E-binding protein 1 pot
... of the RAIP motif We therefore also tested the binding of raptor to full-length 4E-BP1 and to the RAIP ⁄ AAAA variant A marked and reproducible 2188 decrease was seen for the RAIP ⁄ AAAA mutant, ... position of GST itself (E) Binding of raptor to different amounts of wild-type 4E-BP1 or the AAAA mutant, assessed using the overlay (far-western) assay The graph shows the quantification of the data ... 2A, D) Proline is an imino, not an amino, acid: arguably the most closely related amino acid is valine Although the AAIP mutant showed substantial basal phosphorylation at Thr36 ⁄ 45 (which was...
- 15
- 337
- 0
Báo cáo khoa học: Identification and expression of the first nonmammalian amyloid-b precursor-like protein APLP2 in the amphibian Xenopus laevis ppt
... as the absence of the exon encoding the KPI domain and the lack of a second heparin-binding domain [3,4,13,26] Comparative analysis of the Xenopus and mammalian APLP2 proteins Comparing the amino ... protocol of the manufacturer (Clontech, MarathonTM cDNA amplification kit) 5¢-RACE was performed using adaptor primer 5¢-CCATCCTAATAC GACTCACTATAGGGC-3¢ and gene specific reverse primer 5¢-CAGCAAGTACGTGGTGGTAATGACGG-3¢ ... under the guidelines of the Dutch law concerning animal welfare Rapid amplification of 5¢ cDNA ends To generate a pool of adaptor-ligated double stranded cDNAs, total Xenopus brain RNA was isolated...
- 7
- 405
- 0
Báo cáo khoa học: Glycogen synthase kinase 3b and b-catenin pathway is involved in toll-like receptor 4-mediated NADPH oxidase 1 expression in macrophages ppt
... Novel isoforms of NADPH-oxidase in cerebral vascular control Pharmacol Ther 111, 928–948 11 Csanyi G, Taylor WR & Pagano PJ (2009) NOX and inflammation in the vascular adventitia Free Radic Biol ... oxidase Mox1 Nature 401, 79–82 Rokutan K, Kawahara T, Kuwano Y, Tominaga K, Sekiyama A & Teshima-Kondo S (2006) NADPH oxidases in the gastrointestinal tract: a potential role of Nox1 in innate immune ... modification of target proteins [29] ROS are also considered important in macrophage activation, because this process is significantly related to the pathogenesis of inflammatory diseases such as atherosclerosis...
- 8
- 340
- 0
Báo cáo khoa học: Identification of an osteopontin-like protein in fish associated with mineral formation pot
... AAAACCCAGGAGATAAACTCAAGACAACCCA AGAACCGTGGCAAAGAGCAGAACGAA AAGAGGAACACAACTCACTGCCCCAC GCTTGCCTTTGCCCAGAACTTTGTAG from SSH (a, b and c in Fig 1A) and used in a combination of RACE and standard PCR amplifications ... SaOP3-F03 SaOP2-R04 SaOPreal-FW SaOPreal-RV SaRPL2 7a- FW SaRPL2 7a- RV CGCTCCAGCCGCTGAACTCCTGAAGC CCACCCCTCAGCCCATCGACCCTACC GGCGGGACCTGACACCACCACTGACA GGTAGGGTCGATGGGCTGAGGGGTGG AAAACCCAGGAGATAAACTCAAGACAACCCA ... Selected features of osteopontin (mammals) and osteopontin-like (fish) proteins CKII, casein kinase II; MGCK, mammary 30 gland casein kinase Asn, asparginine; Asp, aspartic acid; Glu, glutamic acid;...
- 12
- 445
- 0
Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf
... (Kansas City, KS, USA) Plasmids and cloning procedures For heterologous expression in yeast, N crassa HEX1 was amplified from a N crassa cDNA library using PCR with primer pair RE951 (AAGAATTCATGGGCTACTACGA ... [22] Media for the cultivation of yeast and bacterial strains were prepared as described elsewhere [23,24] N crassa strain FGSC#987 (St Lawrence 74-OR23- 1A, mat A) was obtained from the Fungal Genetics ... Collinge AJ (1974) Occlusion of the septal pores of damaged hyphae of Neurospora crassa by hexagonal crystals Protoplasma 80, 57–67 19 Yuan P, Jedd G, Kumaran D, Swaminathan S, Shio H, Hewitt D, Chua...
- 10
- 350
- 0
Báo cáo khóa học: Overexpression and enzymatic characterization of Neisseria gonorrhoeae penicillin-binding protein 4 ppt
... mixture containing all components of the CPase assay except for the substrate Ac2-KAA was then added to the assay Reactions were stopped by the addition of developing reagent containing AR and ampicillin ... Transpeptidase activity No transpeptidase product was observed for NG PBP catalyzed transpeptidation reactions with glycine as the transpeptidase acceptor and Ac2-KAA as the acyl group donor A constant ... two substrates, Ac2-KAA and Ac2-KA-D-Lac, the values for kcat and Km reported in Table are given as the apparent values, and are the minimum values for these parameters ) the true values could...
- 10
- 328
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25