accessing elements of a single dimensional array

Tài liệu Elements of a PR Plan pptx

Tài liệu Elements of a PR Plan pptx

... or transparencies Press packages may include black-and-white photos and state that color material also is available via your Web site’s press section Audio Tapes for Radio Audio tapes are rarely ... becoming a major publicity tool as people take advantage of the Web’s multimedia capabilities Webcasts can be live events or archived and available on demand They are a cost-effective, instantaneous ... relations person is to facilitate the selection and training of an appropriate and available expert Media training can range from a brief 15-minute coaching session to two-day, videotaped seminars...

Ngày tải lên: 23/12/2013, 00:15

15 433 1
Family Life, Reproductive Health, and Population Education: Key Elements of a Health-Promoting School docx

Family Life, Reproductive Health, and Population Education: Key Elements of a Health-Promoting School docx

... scope and amount of services that can be provided, the availability of trained staff, and the capacity to plan and evaluate efforts Knowing this information allows the team to draw on available ... Control and Prevention (CDC), Atlanta, USA Naomi Nhiwatiwa World Health Organization (WHO)/Regional Office for Africa, Harare, Zimbabwe Shanti Noriega-Minichiello World Health Organization (WHO)/Headquarters, ... Ministry of Health, Jakarta, Indonesia Robert Thomson World Health Organization (WHO)/Headquarters, Geneva, Switzerland Catharine Watson Straight Talk Foundation, Kampala, Uganda FAMILY LIFE, REPRODUCTIVE...

Ngày tải lên: 22/03/2014, 12:20

90 469 0
Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf

Báo cáo khoa học: Dynamin-like protein-dependent formation of Woronin bodies in Saccharomyces cerevisiae upon heterologous expression of a single protein pdf

... Collinge AJ (1974) Occlusion of the septal pores of damaged hyphae of Neurospora crassa by hexagonal crystals Protoplasma 80, 57–67 19 Yuan P, Jedd G, Kumaran D, Swaminathan S, Shio H, Hewitt D, Chua ... bodies of N crassa are smaller with an average size of 2934 To corroborate the appearance of hexagonal HEX1 structures in BY4742, this strain was also analyzed by electron microscopy The untransformed ... secondary antibodies applied were obtained from Molecular Probes (Alexa Fluor 594 goat anti-rabbit IgG and Alexa Fluor 488 goat anti-mouse IgG) Acknowledgements We thank F Nargang for the N crassa...

Ngày tải lên: 23/03/2014, 07:20

10 350 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
báo cáo hóa học: " Psychometric properties of a single-item scale to assess sleep quality among individuals with fibromyalgia" potx

báo cáo hóa học: " Psychometric properties of a single-item scale to assess sleep quality among individuals with fibromyalgia" potx

... medication up to and including Day1 If fewer than scores are available then baseline consists of all scores that are available Page of (page number not for citation purposes) Health and Quality of ... clinical trials During the baseline phase, study patients had to have an average daily diary pain score of at least (within the last days) on a numeric rating scale ranging from ("no pain") to ... 1056 and 91.0% in study 1077) (Table 1) In study 1056, the mean age of patients was 48.8 years and the average duration of FM was years In study 1077, the mean age of patients was 50.1 years and...

Ngày tải lên: 18/06/2014, 18:20

7 597 0
Báo cáo hóa học: "Dynamics of a two-dimensional system of rational difference equations of Leslie–Gower type" doc

Báo cáo hóa học: "Dynamics of a two-dimensional system of rational difference equations of Leslie–Gower type" doc

... other than u1 and u2, then the interior of 〚u1, u2〛 is either a subset of the basin of attraction of u1 or a subset of the basin of attraction of u2 Kalabušić et al Advances in Difference Equations ... subset of the basin of attraction of E All orbits that start below this curve are attracted to E1 All orbits that start above this curve are attracted to E (A1 − A2 − β1 + γ2 ) 4B2 R13 A1 = β1 , A1 ... obtain Tn((x, y)) ® (∞, 0) as n ® ∞, as which completes the proof of theorem Author details Department of Mathematics, University of Sarajevo, Sarajevo, Bosnia and Herzegovina 2Department of Mathematics,...

Ngày tải lên: 21/06/2014, 00:20

29 241 0
báo cáo hóa học:" Research Article Design and Implementation of a Single-Frequency Mesh Network Using OpenAirInterface" docx

báo cáo hóa học:" Research Article Design and Implementation of a Single-Frequency Mesh Network Using OpenAirInterface" docx

... channel measurements which can be used for channel characterization and capacity analysis [2] Apart from a general overview of OpenAirInterface, in this paper we present OpenAirMesh a specification ... to transport data traffic corresponding to a particular flow Table 4: Transport and physical channels Each of the transport channels is mapped to a corresponding physical channel of the same name ... the means for exploiting channel state feedback at the transmitters in order to allow for advanced PHY allocation of OFDMA resources via the MAC In addition to the physical channels of Table 4,...

Ngày tải lên: 21/06/2014, 18:20

16 769 0
Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc

Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc

... five Si layers (200 Si atoms) and a *12 A vacuum layer The bottom of the slab has a bulk-like structure with each Si atom saturated by an H atom All atoms except for the H and Si atoms at the bottom ... densities of the clean Si substrate, 19H-Si(111)- and isolated H atoms are calculated with the same lattice parameters and atomic positions as the relaxed Ag adsorbed 19H-Si(111)-7 surface This allows ... the H atoms on the Si surface, we observe that the charge accumulates around the Ag atom, and strongly depletes around the Si adatom, rest atom and the third adjacent Si atom at the second layer...

Ngày tải lên: 22/06/2014, 00:20

6 368 0
Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

... containing solvents are used As it was indicated by Efrima et al [24], Lewis base alkylamine solvents promote the decomposition reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates ... solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band gap for SnS NCs compared with the bulk material can be explained by quantum confinement ... allowed transition with an energy gap of 1.6 eV for the nanocrystalline particles, higher than the literature value (1.1 eV) for bulk films of SnS [30, 31] Calculated the same way band gap value of sub-200...

Ngày tải lên: 22/06/2014, 22:20

5 365 0
Báo cáo hóa học: " Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" ppt

Báo cáo hóa học: " Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" ppt

... containing solvents are used As it was indicated by Efrima et al [24], Lewis base alkylamine solvents promote the decomposition reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates ... solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band gap for SnS NCs compared with the bulk material can be explained by quantum confinement ... allowed transition with an energy gap of 1.6 eV for the nanocrystalline particles, higher than the literature value (1.1 eV) for bulk films of SnS [30, 31] Calculated the same way band gap value of sub-200...

Ngày tải lên: 22/06/2014, 22:20

5 276 0
Báo cáo hóa học: " Analysis of a Combined Antenna Arrays and Reverse-Link Synchronous DS-CDMA System over Multipath Rician Fading Channels" doc

Báo cáo hóa học: " Analysis of a Combined Antenna Arrays and Reverse-Link Synchronous DS-CDMA System over Multipath Rician Fading Channels" doc

... paper, we consider that the array geometry, which is the parameter of the antenna aperture gain, is a uniform linear array (ULA) of M identical sensors All signals from MS arrive at the BS AA ... , θl(k) , and τl(k) are phase shift, mean angle of l arrival (AOA), and the propagation delay, respectively, of the lth faded path of the kth user Assuming Rayleigh fading, the probability density ... sensor spacing is half the carrier wavelength, and an important parameter that characterizes a Rician fading channel is defined as the ratio of the specular component power to the Rayleigh fading...

Ngày tải lên: 23/06/2014, 00:20

10 236 0
The Integration of Functions of a Single Variable, by G. H. Hardy pptx

The Integration of Functions of a Single Variable, by G. H. Hardy pptx

... either algebraical or the sum of an algebraical function and of a finite number of constant multiples of logarithms of algebraical functions All algebraical functions which occur in the integral are ... Integrals of algebraical functions in general 38 11–14 The general form of the integral of an algebraical function Integrals which are themselves algebraical 38 15 Discussion of a particular case 45 ... operations which are always practicable And it has been shown, more generally, that we can always determine by means of such operations whether the integral of any given algebraical function is algebraical...

Ngày tải lên: 28/06/2014, 19:20

86 262 1
Báo cáo khoa học: " Persistent occurrence of a single Streptococcus equi subsp. zooepidemicus clone in the pig and monkey population inIndonesia" ppsx

Báo cáo khoa học: " Persistent occurrence of a single Streptococcus equi subsp. zooepidemicus clone in the pig and monkey population inIndonesia" ppsx

... Isrina Oktavia Salasia et al reactions and with a commercial grouping kit (Slidex Strepto-kit bioMerieux, Nürtingen, Germany) The growth pattern of the bacteria in fluid media and the morphology of ... and with compact colonies in soft agar The growth properties of these three bacteria obtained from the original outbreak had already been described [15] According to studies of Abdulmawjood and ... (Biolabs, Schwalbach, Germany) [1] The preparation and SmaI digestion of the chromosomal DNA for macrorestriction analysis of the isolates by pulsed-field gel electrophoresis was performed as described...

Ngày tải lên: 07/08/2014, 18:20

3 314 0
Báo cáo y học: "Vaccination response to tetanus toxoid and 23-valent pneumococcal vaccines following administration of a single dose of abatacept: a randomized, open-label, parallel group study in healthy subjects" pot

Báo cáo y học: "Vaccination response to tetanus toxoid and 23-valent pneumococcal vaccines following administration of a single dose of abatacept: a randomized, open-label, parallel group study in healthy subjects" pot

... levels Anti-tetanus and anti-pneumococcal (Danish serotypes 2, 6B, 8, 9V, 14, 19F and 23F) antibody titers were measured by ELISA at 14 and 28 days after vaccination by a central laboratory Abatacept ... days after vaccination (μg/ml) 28 days after vaccination (μg/ml) N /A N /A N /A N /A N /A 28.6 (26) Group C (vaccines weeks after abatacept) N /A 12.5 (19) 6.1 (20) Group D (vaccines weeks after abatacept) ... London, UK, and on the procedures of the Department of Pathology, University of Alabama at Birmingham, AL, USA [14] All analyses were carried out at the Center for Vaccine Research and Development,...

Ngày tải lên: 09/08/2014, 10:20

11 415 0
Báo cáo y học: "Association of a single nucleotide polymorphism in growth differentiate factor 5 with congenital dysplasia of the hip: a case-control study" ppt

Báo cáo y học: "Association of a single nucleotide polymorphism in growth differentiate factor 5 with congenital dysplasia of the hip: a case-control study" ppt

... Genet A 2003, 11 7A: 136-142 20 Miyamoto Y, Mabuchi A, Shi D, Kubo T, Takatori Y, Saito S, Fujioka M, Sudo A, Uchida A, Yamamoto S, Ozaki K, Takigawa M, Tanaka T, Nakamura Y, Jiang Q, Ikegawa S: A ... Nishimura G, Kawabata H, Yokoyama H, Yoshida A, Tominaga S, Nagano J, Shimizu A, Wakana S, Gondo Y, Noda T, Shiroishi T, Ikegawa S: A novel dominant-negative mutation in Gdf5 generated by ENU mutagenesis ... Yanamandra N, Goodman FR, Mendoza-Londono JR, Savarirayan R, White SM, Graham JM Jr, Gale RP, Svarch E, Newman WG, Kleckers AR, Francomano CA, Govindaiah V, Singh L, Morrison S, Thomas JT, Warman...

Ngày tải lên: 09/08/2014, 13:22

5 444 0
Báo cáo y học: " Carinal surgery: experience of a single center and review of the current literature" potx

Báo cáo y học: " Carinal surgery: experience of a single center and review of the current literature" potx

... optimal anaesthetic and surgical strategies are to be taken into consideration Anaesthetic strategies Multidisciplinary team approach and close collaboration with the anaesthetist, is required Page ... lobectomy years ago CP: carinal plasty with reinplantation of the right main bronchus to the trachea for Tracheal Sarcoma (TS) or carcinoid tumor A: Alive D:Dead The postoperative mortality was 12.5% ... alignment and drafted the manuscript and VY participated in its design and coordination The authors read and approved the manuscript Author Details 1Cardiothoracic Department, Royal Victoria Hospital,...

Ngày tải lên: 10/08/2014, 09:22

7 311 0
báo cáo khoa học: " Simultaneous measurement of sensor-protein dynamics and motility of a single cell by on-chip microcultivation system" pps

báo cáo khoa học: " Simultaneous measurement of sensor-protein dynamics and motility of a single cell by on-chip microcultivation system" pps

... when bacterium was stimulated by aspartate Dashed lines show bacterial division points after 80 of stimulation by aspartate, localized Tar was diffused completely Then, the aspartate was removed ... bacterial chemotaxis: receptor dimers in signalling arrays Molecular Microbiology 1998, 30:459-466 Manson MD, Armitage JP, Hoch JA, Macnab RM: Bacterial locomotion and signal transduction J Bacteriol ... First, a single bacterium was placed in a microchamber and was isolated in the wheel region to swim along the track by sealing of semipermiable membrane lid onto the microchamber Then, the bacterium...

Ngày tải lên: 11/08/2014, 00:22

4 166 0
báo cáo khoa học:" Reliability and validity of a single item measure of quality of life scale for adult patients with cystic fibrosis" pot

báo cáo khoa học:" Reliability and validity of a single item measure of quality of life scale for adult patients with cystic fibrosis" pot

... scale measure and body image may suggest that adult patients with CF may have adopted a level of negative image (stigma) of the disease in manner that is different from an adaptation to physical ... feasibility of administration the testretest reliability and the validity of a single- item global quality of life scale We also examined the relationship of the single item global quality of ... quality of life scale: ‘this must be balanced against the practicality of ascertaining such information Brevity may come at a cost of detail.’ [16] Clinical implication We believe that the single...

Ngày tải lên: 11/08/2014, 23:22

8 206 0
Báo cáo khoa học: " Phylogenetic studies reveal existence of multiple lineages of a single genotype of DENV-1 (genotype III) in India during 1956–2007" pdf

Báo cáo khoa học: " Phylogenetic studies reveal existence of multiple lineages of a single genotype of DENV-1 (genotype III) in India during 1956–2007" pdf

... AMV-RT, and respective sense and antisense primers [(D1: 5'-TCAATATGCTGAAACGCGCGAGAAACCG-3') (D2: 5'-TTGCACCAACAGTCAATGTCTTCAGGTTC-3')] [26] in a thermal cycler (BioRad, USA) The thermal profile of ... Southeast Asian J Trop Med Public Health 2001, 32:326-35 Kukreti H, Chaudhary A, Rautela RS, Anand R, Mittal V, Chhabra M, Bhattacharya D, Lal S, Rai A: Emergence of an independent lineage of dengue ... East Asian countries viz Cambodia, Vietnam, Thailand and Singapore; recent isolates from China and very old strain from Japan (Japan 43 Mochizuki strain) are the only strains from North Asia...

Ngày tải lên: 12/08/2014, 04:21

9 464 0
w