access query to find duplicate records in a table

Tài liệu Find Records in a Table Without Corresponding Entries in a Related Table pptx

Tài liệu Find Records in a Table Without Corresponding Entries in a Related Table pptx

... Orders.CustomerID" & vbCrLf 6.4 Find Records in a Table Without Corresponding Entries in a Related Table I have a situation in which I need to find which clients don't have invoices. ... Technique To find out which records (customers) don't have corresponding records (invoices) in a related table, you have to have a better understanding of the types of joins that can be used ... include inner joins, left outer joins, and right outer joins. Inner Join This join displays records in which at least one record exists in each table for the joined field. This means that...

Ngày tải lên: 21/01/2014, 12:20

5 274 0
What To Do If Trapped In A Lift With A Dentist

What To Do If Trapped In A Lift With A Dentist

... message to make the Mac users laugh. 4 Pretend you're using an i-pod by placing a bee in each ear and holding a gaudy pencil case to be in a pain in everyone's rear. 5 Entertain the passengers stretch ... others history is a corpse leave it alone it teaches us nothing except how to repeat past mistakes again and again and again WAR War what is it good for? Reinvigorating depressed economies and winning ... Sellotape a photo of Hitler onto a beer mat and then smear his face with a gallon of pig fat. 3 Pretend you're using a laptop by folding some cardboard in half and writing a windows error...

Ngày tải lên: 14/11/2012, 16:50

34 515 0
Tài liệu Counting Records in a DataReader ppt

Tài liệu Counting Records in a DataReader ppt

... DataReader provides forward-only, read-only access to a stream of rows from a data source. It is optimized for performance by reading data directly from a connection to a data source. As a ... HasRows( ) method of the DataReader was introduced in Version 1.1 of the .NET Framework. It returns a Boolean value indicating whether the DataReader contains at least one row. There is also ... backwards in DataReader so when iterating, you must process data at the same time. This technique provides the only accurate count of records in the DataReader. A second technique demonstrated...

Ngày tải lên: 24/12/2013, 05:15

4 373 0
Tài liệu Báo cáo khoa học: "Using Automatically Transcribed Dialogs to Learn User Models in a Spoken Dialog System" doc

Tài liệu Báo cáo khoa học: "Using Automatically Transcribed Dialogs to Learn User Models in a Spoken Dialog System" doc

... University Princeton, NJ 08540, USA usyed@cs.princeton.edu Jason D. Williams Shannon Laboratory AT&T Labs — Research Florham Park, NJ 07932, USA jdw@research.att.com Abstract We use an EM algorithm to ... we cannot assume that the tran- scripts will accurately reflect the users’ true actions and internal states. To handle this uncertainty, we employ an EM algorithm that treats this information as ... θ be the maximum likelihood estimate using automatically transcribed data, i.e., θ asu = e K D as P a e K D as . This approach ignores transcription errors and assumes that user be- havior depends...

Ngày tải lên: 20/02/2014, 09:20

4 471 0
How to use English effectively in a formal meeting

How to use English effectively in a formal meeting

... chair is expected to have a remarkable ability in presentation technique and has a distinctive and influential social role involved in taking the chair at a meeting. Since meeting is a gathering ... effectiveness in using language in a formal meeting to conclude what gained from my study. Due to the knowledge and experience limitation, grammatical spelling and typing mistakes are unavoidable in ... requires a meeting, or meetings of some sort. E.g.: We are having a meeting on Thursday to look at the proposal again. Or in more details, meeting is a concept dominating three factors: + When a...

Ngày tải lên: 18/03/2014, 00:16

53 584 0
Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt

Báo cáo khoa học: LIN54 is an essential core subunit of the DREAM / LINC complex that binds to the cdc2 promoter in a sequence-specific manner ppt

... D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... GHIF ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTTAAGATCT CHRup MYB1 ATTTGAACTAGACCAATGCTGGGAGAAAAAATTTAAGATCT Mut A ATTTGAACTGTGAAGATGCTGGGAGAAAAAATTTAAGATCT Mut B Mut C Mut D ATTTGAACTGTGCCAGGACTGGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGAGAGGAGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGAAGGAAAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAAGGAAAATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAGGGATTTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAGGGTAAGATCT ATTTGAACTGTGCCAATGCTGGGAGAAAAAATTGGGGATCT Mut ... 5Â-GGCGGATCCAAGCCAGTGGTTGTTAAT AC-3Â and 5Â-GCCTCGAGAATCAAGTGTCCCTGCACC T-3Â (LIN-54-DN); 5Â-GCGGATCCGAGGTGGTGCCAG CTGAG-3Â,5Â-GCTCTAGAGAATGGAAGCCGTGCCT G-3Â,5Â-GCTCTAGATTGGCAGATGCAGCTGAAGTA- 3Â and 5Â-GCCTCGAGAATCAAGTGTCCCTGCACCT-3Â (LIN-54-DCXC);...

Ngày tải lên: 23/03/2014, 04:20

14 456 0
Báo cáo khoa học: An orphan dermaseptin from frog skin reversibly assembles to amyloid-like aggregates in a pH-dependent fashion pptx

Báo cáo khoa học: An orphan dermaseptin from frog skin reversibly assembles to amyloid-like aggregates in a pH-dependent fashion pptx

... ThT-binding capabil- ity, similar to the metastable aggregates of aDrs. Inter- estingly, the same behaviour was observed for a C-terminally amidated aDrs (aDrsa) (data not shown). However, C-terminal ... Gharibyan AL, Zamotin V, Yanamandra K, Moskaleva OS, Margulis BA, Kostanyan IA & Morozova-Roche LA (2007) Lysozyme amyloid oligomers and fibrils induce cellular death via different apoptotic ... supernatants was determined with a Cyto Tox 96Ò non-radioactive cyto- toxicity assay (Promega, Madison, WI, USA) according to the manufacturer’s instructions. Untreated cells were used to determine...

Ngày tải lên: 23/03/2014, 04:20

11 412 0
Báo cáo khoa học: "HOW TO DETECT GRAMMATICAL ERRORS IN A TEXT WITHOUT PARSING IT" doc

Báo cáo khoa học: "HOW TO DETECT GRAMMATICAL ERRORS IN A TEXT WITHOUT PARSING IT" doc

... general Constituent Likelihood approach to grammatical analysis, and CLAWS in particular, can be used to analyse text including ill-formed syntax. More importantly, it can also be adapted to ... that this approach was impractical because of the time and effort required to collect the necessary data. In any case, an alternative technique which managed without a separate table of tag-pair ... and then measuring ABSOLUTE LIKELIHOODS of tag- pairs. Instead of a separate tag-pair error likelihood table to assess the grammaticality, the same tag-pair frequency table is used for tag-assignment...

Ngày tải lên: 24/03/2014, 05:21

8 471 0
Báo cáo " Self-regulated strategy development as a means to foster learner autonomy in a writing course " pdf

Báo cáo " Self-regulated strategy development as a means to foster learner autonomy in a writing course " pdf

... believes that autonomy helps learning and that learner training can contribute to promoting learner autonomy. Information about learner beliefs about language learning, learner autonomy and self-regulation ... Learner Autonomy in Language Learning: Defining the Field and Effecting Change, Franfurt: Peter Lang, 1999. [5] P. Benson, Autonomy in language teaching and learning, Language Teaching 40 ... the task against the stated objectives/goals. - Evaluators: The teacher and the students directly involve in evaluating the task. - Timing: The evaluation will take place both during and after...

Ngày tải lên: 28/03/2014, 11:20

8 518 4
Báo cáo khoa học: Adaptation to G93Asuperoxide dismutase 1 in a motor neuron cell line model of amyotrophic lateral sclerosis The role of glutathione doc

Báo cáo khoa học: Adaptation to G93Asuperoxide dismutase 1 in a motor neuron cell line model of amyotrophic lateral sclerosis The role of glutathione doc

... conditions and after t-BHQ treatment (Fig. 8A) , indicating that highG9 3A- tTA cells had a lower antioxidant capacity than those expressing a comparable level of wtSOD1. In lowG9 3A- tTA cells, total GSH after ... system (Amersham Biosciences, Little Chalfont, UK). Films were scanned and band intensities obtained with an AIS Image Analyser (Imaging Research Inc., St Catharine’s, Canada). Enzymatic activities Cells ... dissolved in sodium phosphate EDTA and water to 1 mL. After 2 min preincubation, 0.6 U GR was added to the 1-mL assay mixture and the change in absorbance at 412 nm was measured over 3 min. Standard...

Ngày tải lên: 29/03/2014, 23:20

14 369 0
Báo cáo hóa học: " Evaluation of liver enzyme levels in workers exposed to vinyl chloride vapors in a petrochemical complex: a cross-sectional study" pot

Báo cáo hóa học: " Evaluation of liver enzyme levels in workers exposed to vinyl chloride vapors in a petrochemical complex: a cross-sectional study" pot

... Occupational Health Center, Ministry of Health & Medical Education, Tehran, Iran Email: Mir Saeed Attarchi* - msattarchi@yahoo.com; Omid Aminian - oaminian@sina.tums.ac.ir; Mandana Dolati ... mandanadolati@yahoo.com; Maria Mazaheri - maria_mazaheri@hotmail.com * Corresponding author Abstract Background: Polyvinyl chloride is used in production and manufacturing of many essential tools (e.g. ... exposed to VCM [1]. VCM is hepatotoxic and carcinogenic and can cause liver damages such as hepatic fibrosis, hepatic angiosarcoma, hepatocellular carcinoma, portal hypertension, etc. The mechanism...

Ngày tải lên: 20/06/2014, 00:20

6 380 0
báo cáo hóa học:" CCR9 interactions support ovarian cancer cell survival and resistance to cisplatin-induced apoptosis in a PI3K-dependent and FAK-independent fashion" pdf

báo cáo hóa học:" CCR9 interactions support ovarian cancer cell survival and resistance to cisplatin-induced apoptosis in a PI3K-dependent and FAK-independent fashion" pdf

... Hayasaka T, Mabuchi S, Saitoh M, Kawagoe J, Takahashi K, Igarashi H, Du B, Doshida M, Mirei IG, Motoyama T, Tasaka K, Kurachi H: Inhibition of Phosphatidylinositol 3-Kinase Increases Efficacy ... 25:7381-7390. 17. Arimoto-Ishida E, Ohmichi M, Mabuchi S, Takahashi T, Ohshima C, Hayakawa J, Kimura A, Takahashi K, Nishio Y, Sakata M, Kurachi H, Tasaka K, Murata Y: Inhibition of phosphorylation of a forkhead ... resistance to chemotherapy by inactivating apoptotic factors and enhancing survival pathways that antagonize apoptotic signals [2]. The first- line chemotherapeutic agent for OvCa is cisplatin. Unfor- tunately,...

Ngày tải lên: 20/06/2014, 07:20

8 316 0
Báo cáo hóa học: " Research Article A Dual Decomposition Approach to Partial Crosstalk Cancelation in a Multiuser DMT-xDSL Environment" docx

Báo cáo hóa học: " Research Article A Dual Decomposition Approach to Partial Crosstalk Cancelation in a Multiuser DMT-xDSL Environment" docx

... 1) table is initialized containing the average capacity increases per allocated crosstalk cancellation tap. For each of K tones the capacity increase has to be calculated for all N − 1 crosstalk ... v k s (r s ), as follows: (i) the average capacity increase for allocating less or equal crosstalk cancellation taps than r s is set to zero, (ii) the average capacity increase for allocating more crosstalk ... cancellation taps are allocated. Note that in each iteration of the algorithm a minimum of 1 and a maximum of N − 1 crosstalk cancel- lation taps are allocated. Because of this varying granularity, the...

Ngày tải lên: 22/06/2014, 20:20

11 400 0
Báo cáo lâm nghiệp: "Opportunistic methods of controlling vegetation, inspired by natural plant succession dynamics with special reference to natural outmixing tendencies in a gap regeneration" pps

Báo cáo lâm nghiệp: "Opportunistic methods of controlling vegetation, inspired by natural plant succession dynamics with special reference to natural outmixing tendencies in a gap regeneration" pps

... desire to reduce chemical applications means that research must be conducted into alternative, affordable meth- ods of vegetation management. This applies to natural as well as artificial regeneration, ... observation trial in an area of natural regeneration under a canopy gap. This was created specifically for regeneration during the winter of 1987/1988 at Affoltern, Switzerland, using the irregular ... social differentiation over time, trees were separated into three data subsets according to the actual light climate i.e. taking into account subsequent gap enlargement (Fig. 6). Up to year 7,...

Ngày tải lên: 08/08/2014, 01:22

8 369 0
Báo cáo lâm nghiệp: "Micrometeorological assessment of sensitivity of canopy resistance to vapour pressure deficit in a Mediterranean oak forest * " potx

Báo cáo lâm nghiệp: "Micrometeorological assessment of sensitivity of canopy resistance to vapour pressure deficit in a Mediterranean oak forest * " potx

... figure 1a. Most of the avail- able energy was dissipated as latent heat in the morning, while an increasing amount of heat was released after midday. Peak energy flux into the ... by many authors in a range of environments. McNaughton and Black (1973), in trying to explain the afternoon increase in canopy surface resistance noted in a Douglas-fir ... Mediterranean oak forest that has been investigated seems to dissipate most of the available energy as latent heat in the morn- ing and gradually increase the release of sensible...

Ngày tải lên: 08/08/2014, 18:21

8 271 0
w