aca mca and pca cerebral artery syndromes

báo cáo hóa học: " Effects of the cyclooxygenase-2 inhibitor nimesulide on cerebral infarction and neurological deficits induced by permanent middle cerebral artery occlusion in the rat" potx

báo cáo hóa học: " Effects of the cyclooxygenase-2 inhibitor nimesulide on cerebral infarction and neurological deficits induced by permanent middle cerebral artery occlusion in the rat" potx

... intraluminal occluder had entered the anterior cerebral artery and occluded the origin of the anterior cerebral artery, the middle cerebral artery (MCA) and posterior communicating arteries [27] After ... nimesulide in the treatment of cerebral ischemia List of abbreviations used COX-2, cyclooxygenase-2; pMCAO, permanent middle cerebral artery occlusion; MCA, middle cerebral artery; TTC, 2,3,5-triphenyltetrazolium ... artery occlusion (pMCAO) Figure Temporal development of focal cerebral infarction induced by permanent middle cerebral artery occlusion (pMCAO) (A): Evolution of cortical and subcortical infarct...

Ngày tải lên: 19/06/2014, 22:20

11 568 0
Báo cáo khoa học: " Canine model of ischemic stroke with permanent middle cerebral artery occlusion: clinical and histopathological findings" docx

Báo cáo khoa học: " Canine model of ischemic stroke with permanent middle cerebral artery occlusion: clinical and histopathological findings" docx

... Transverse (A and B) and dorsal (C and D) T1-weighted and T2-weighted MR images of the brain in an experimentally embolized dog (ID 2) Hypointense (A and C) and hyperintense (B and D) lesions were ... Crespigny A Middle cerebral artery occlusion in Macaca fascicularis: acute and chronic stroke evolution J Med Primatol 2006, 35, 78-86 Diaz FG, Mastri AR, Ausman JI, Chou SN Acute cerebral revascularization: ... Necropsy, TTC staining, and histopathology Atrophic and necrotic lesions were observed on the ventral surface of the left cerebral cortex (ID 1) and the lateral surface of the left cerebral cortex (ID...

Ngày tải lên: 07/08/2014, 20:23

8 260 0
A middle cerebral artery occlusion modelling study of combinatorial treatment (acute phase) and post ischemic exercise (chronic phase) in rats

A middle cerebral artery occlusion modelling study of combinatorial treatment (acute phase) and post ischemic exercise (chronic phase) in rats

... of the MCAo model with occlusion of the MCA together with ipsilateral common carotid artery (CCA) reduces cerebral blood flow (CBF) leading to the core and periphery of the MCA territory and has ... signaling and apoptosis in cortex 3.2.6.1 Effects of exercise and brain ischemia on mRNA and protein expression in TGF-β signaling and caspase activity 89 viii 3.2.6.2 Effects of exercise and brain ... staining of EPO and NeuN in CA1 Fig 32 Double staining of EPOR and NeuN in CA1 Fig 33 Double staining of EPO and NeuN in DG Fig 34 Double staining of EPOR and NeuN in DG Fig 35 EPO and EPOR protein...

Ngày tải lên: 10/09/2015, 15:53

271 233 0
PURIFIED HERBA LEONURI AND LEONURINE  PROTECT MIDDLE CEREBRAL ARTERY OCCLUDED-RATS FROM BRAIN INJURY THROUGH ANTIOXIDATIVE MECHANISM AND MITOCHONDRIAL PROTECTION

PURIFIED HERBA LEONURI AND LEONURINE PROTECT MIDDLE CEREBRAL ARTERY OCCLUDED-RATS FROM BRAIN INJURY THROUGH ANTIOXIDATIVE MECHANISM AND MITOCHONDRIAL PROTECTION

... products and cerebral ischemia His extensive discussions during my course of research and untiring help during my difficult moments have been very helpful His understanding, encouraging and personal ... Immunohistochemical staining of pro-apoptotic protein (b: BAX and c: FAS) and anti-apoptotic protein (d: BCL-2 and e: BCL-XL) in cerebral cortex after days of MCAO (40x magnification), with a: negative control ... Results……………………………………………………………… 89 Results of experiment I: Cerebral Protection of Purified Herba Leonuri Extract on Middle Cerebral Artery Occluded-Rats……………………… 90 4.1.1 Pharmacological and functional outcome studies………………...

Ngày tải lên: 14/09/2015, 08:44

32 138 0
Purified herba leonuri and leonurine protect middle cerebral artery occluded rats from brain injury through antioxidative mechanism and mitochondrial protection 1

Purified herba leonuri and leonurine protect middle cerebral artery occluded rats from brain injury through antioxidative mechanism and mitochondrial protection 1

... neocortex with most susceptible population lies within CA1 and CA4 area of hippocampus and layer and of the cerebral cortex (Taoufik and Probert, 2008) Department of Pharmacology, YLL School of ... preferred ligand is (Fas ligand) FasL (Ashe and Berry, 2003) There were reports on Fas/FasL system that it is also involved in neuronal apoptosis following traumatic brain injury and cerebral ischemia ... type, caspase is the apical caspase in DR signaling and its activity is detected after permanent middle cerebral artery occlusion (MCAO) (Taoufik and Probert, 2008) Department of Pharmacology, YLL...

Ngày tải lên: 14/09/2015, 08:45

48 156 0
Purified herba leonuri and leonurine protect middle cerebral artery occluded rats from brain injury through antioxidative mechanism and mitochondrial protection 3

Purified herba leonuri and leonurine protect middle cerebral artery occluded rats from brain injury through antioxidative mechanism and mitochondrial protection 3

... internationally accept ethical standards 3.3 Middle cerebral artery occlusion (MCAO) Ischemic stroke was induced in the rats by MCAO Before middle cerebral artery occlusion (MCAO) is carried out, surgical ... removing the dura, the left middle cerebral artery (MCA) was exposed Then, MCA was occluded by electrocauterization from the point where it crossed the inferior cerebral vein to a point proximal ... function both in vitro and in vivo 3.4.3.2 In vivo studies – animal treatment and MCAO 100 SD rats weighing 180-220g were randomly divided into five groups: sham-operation (Sham); MCAO group with water...

Ngày tải lên: 14/09/2015, 08:45

30 200 0
Purified herba leonuri and leonurine protect middle cerebral artery occluded rats from brain injury through antioxidative mechanism and mitochondrial protection 4

Purified herba leonuri and leonurine protect middle cerebral artery occluded rats from brain injury through antioxidative mechanism and mitochondrial protection 4

... activities of SOD and GPx in healthy rats (without MCAO) were 15.45±5.1U/mg and 99.2± 19.7U/mg Stroke insult by MCAO caused a significant reduction in SOD and GPx activities, to 8.31±2.9U/mg and 49.3±12.1U/mg ... Immunohistochemical staining of pro-apoptotic protein (b: BAX and c: FAS) and anti-apoptotic protein (d: BCL-2 and e: BCL-XL) in cerebral cortex after days of MCAO (40x magnification), with a: negative control ... Results 4.1 Results of experiment I: Cerebral Protection of Purified Herba Leonuri Extract on Middle Cerebral Artery Occluded Rats 4.1.1 Pharmacological and functional outcome studies 4.1.1.1...

Ngày tải lên: 14/09/2015, 08:45

46 292 0
Purified herba leonuri and leonurine protect middle cerebral artery occluded rats from brain injury through antioxidative mechanism and mitochondrial protection 5

Purified herba leonuri and leonurine protect middle cerebral artery occluded rats from brain injury through antioxidative mechanism and mitochondrial protection 5

... the ischemia and the specific properties of the affected cells In this project, rodent model of permanent focal ischemia by left middle cerebral artery occlusion was employed (MCAO) MCAO was done ... of ATP On the other hand, activated calpains and caspases could eventually cleave and inactivate the ion pumps This situation could lead to the disruption of ion homeostasis and switch the apoptosis ... al, 2003) In healthy individuals, Fas ligand (FasL) and Fas are mainly restricted to the immuno tissues and to sites of immune privilege such as the eye and the testes where they can trigger apoptosis...

Ngày tải lên: 14/09/2015, 08:45

39 297 0
Purified herba leonuri and leonurine protect middle cerebral artery occluded rats from brain injury through antioxidative mechanism and mitochondrial protection6

Purified herba leonuri and leonurine protect middle cerebral artery occluded rats from brain injury through antioxidative mechanism and mitochondrial protection6

... kind of diseases, and contribute substantially to human health, pitfalls and shortcomings in herbal production exist Standardization and effective manufacturing quality control, and supervision ... 1154-1165 Anderson MF, Sims NR Mitochondrial respiratory function and cell death in focal cerebral ischemia J Neurochem 1999, 73(3): 1189-1199 Anderson MF, Sims NR The effects of focal ischemia and ... cytochrome c and caspase-3 immunoreactivities and TUNEL staining after permanent middle cerebral artery occlusion in rats Neurol Res 2000, 22(2):223228 Schwab BL, Guerini D, Didszun C, Bano D, Ferrando-May...

Ngày tải lên: 14/09/2015, 08:45

27 262 0
Gene expression profile in the middle cerebral artery and frontal cortex of hypertensive rabbits

Gene expression profile in the middle cerebral artery and frontal cortex of hypertensive rabbits

... supplied by the middle cerebral artery (MCA) The MCA is by far the largest cerebral artery and is the vessel most commonly affected by cerebrovascular accident (CVA) The MCA supplies most of the ... of hypertension in cerebral vessels 1.3 Middle Cerebral Artery The middle cerebral artery (MCA) is one of the three major paired arteries that supply blood to the cerebrum The MCA arises from the ... temporal lobes and the insular cortices The left and right MCAs rise from trifurcations of the internal carotid arteries and thus are connected to the anterior cerebral arteries and the posterior...

Ngày tải lên: 02/10/2015, 17:13

92 358 0
báo cáo hóa học: " Parecoxib is neuroprotective in spontaneously hypertensive rats after transient middle cerebral artery occlusion: a divided treatment response?" docx

báo cáo hóa học: " Parecoxib is neuroprotective in spontaneously hypertensive rats after transient middle cerebral artery occlusion: a divided treatment response?" docx

... values and ratios on Day and Day after tMCAo ADC values and ratios on Day and Day after tMCAo 3A illustrates the absolute ADC values for each of the tMCAo animals that underwent MRI on Day and Day ... anterior choroidal artery (AChA) (Figure 7) The AChA can be considered an end artery due to the variation in collateral blood supply from the MCA and posterior cerebral artery (PCA) [34] In the ... the LA and MA were coagulated and cut A small arteriotomy was made in the ECA stump and a filament with a rounded tip was introduced and maneuvered into the internal carotid artery (ICA) and advanced...

Ngày tải lên: 19/06/2014, 22:20

19 397 0
Báo cáo khoa học: "Transcranial Doppler ultrasound analysis of resistive index in rostral and caudal cerebral arteries in dogs" pps

Báo cáo khoa học: "Transcranial Doppler ultrasound analysis of resistive index in rostral and caudal cerebral arteries in dogs" pps

... minimum 30 Fig Angiography of cerebral vasculature (A) and Doppler images of the rostral cerebral artery (C), left caudal cerebral artery (B), and right caudal cerebral artery (D) minutes for adapting ... Fig The RI of rostral cerebral artery (RCA) and caudal cerebral artery (CCA) at baseline and at various times following the start of mannitol (1 g/kg), furosemide (1 mg/kg), and saline (5 ml/kg) ... 0.50~0.60 0.50~0.58 0.53~0.60 SD: standard deviation, RCA: rostral cerebral artery, CCA: caudal cerebral artery Table Reproducibility of the RI values of RCA and CCA in dogs Mean SD Reliability...

Ngày tải lên: 07/08/2014, 18:21

6 343 0
Báo cáo y học: "Successful surgical resection of infected left atrial myxoma in a case complicated with disseminated intravascular coagulation and multiple cerebral infarctions: case report" ppt

Báo cáo y học: "Successful surgical resection of infected left atrial myxoma in a case complicated with disseminated intravascular coagulation and multiple cerebral infarctions: case report" ppt

... review, cerebral complications including cerebral infarction, haemorrhage and brain abscess were reported in at least ten cases (16.4%) in the literature, and a systemic embolism including cerebral ... brain and systemic computed tomography (CT) scans or brain MRI had been performed preoperatively in all cases Bacterial cerebral infarction is inclined to be a haemorrhagic infarction, and once cerebral ... the septal wall (allow) with the red thrombus and vegetation (*) (B): Hematoxylin and eosin (HE) and showed that the mass was an atrial myxoma, and gram staining of the infected portion revealed...

Ngày tải lên: 10/08/2014, 09:21

4 543 0
Báo cáo y học: "Estimation of lung vital capacity before and after coronary artery bypass grafting surgery: a comparison of incentive spirometer and ventilometry" pps

Báo cáo y học: "Estimation of lung vital capacity before and after coronary artery bypass grafting surgery: a comparison of incentive spirometer and ventilometry" pps

... measures of central tendency and dispersion and expressed as averages and standard deviation Dichotomous or categorical variables were evaluated with frequency measures and presented as percentages ... operatory (15 men) and 32 patients in post operatory (21 men) (table 1) In table averages and DVC standard deviation patterns accomplished through ventilometry and spirometry in pre and post operatory ... measured by ventilometer and Incentive spirometer before and after CABG surgery The execution order of DVC techniques measured with ventilometer and incentive spirometer were randomized through sealed...

Ngày tải lên: 10/08/2014, 09:21

5 343 0
Báo cáo y học: " Evolution of changes in the computed tomography scans of the brain of a patient with left middle cerebral artery infarction: a case report" pps

Báo cáo y học: " Evolution of changes in the computed tomography scans of the brain of a patient with left middle cerebral artery infarction: a case report" pps

... invasive and interventional modalities of treatment in acute stroke due to infarction Abbreviations CT: computed tomography; HMCAS: hyperdense middle cerebral artery sign; MCA: middle cerebral artery; ... hemispherical sulcus effacement and the hyperdense MCA sign (HMCAS) [3] The HMCAS is due to thrombus within this vessel and indicates the likely development of an extensive MCA infarction There may ... CT brain scan in acute middle cerebral artery (MCA) infarction may initially appear normal and the low density area may not be apparent Some early signs of acute MCA infarction are loss of definition...

Ngày tải lên: 11/08/2014, 23:21

4 508 0
Báo cáo y học: " Endothelial cell apoptosis in chronically obstructed and reperfused pulmonary artery" pps

Báo cáo y học: " Endothelial cell apoptosis in chronically obstructed and reperfused pulmonary artery" pps

... withdaysto animals with stimulation artery ligation for rings and andphenylephrine produced weeks, AR)maximal5contraction calciumthe leftligaPercent by acetylcholinearteryweeks,takenearlier,ionophore ... stimulation and calcium ionophore stimulation of pulmonary artery rings taken from the left lungs of sham animals (S), animals with chronic ischemia (left pulmonary artery ligation for weeks, L), and ... after ligation of the left pulmonary artery (L) (*p = 0.0003 and *p = 0.0025, respectively) and significantly decreased after acute reperfusion (AR) ($p = 0.0008 and $p = 0.0163, respectively) Page...

Ngày tải lên: 12/08/2014, 15:21

10 264 0
Báo cáo y học: "Plasma concentrations of Gas6 (growth arrest specific protein 6) and its soluble tyrosine kinase receptor sAxl in sepsis and systemic inflammatory response syndromes" pps

Báo cáo y học: "Plasma concentrations of Gas6 (growth arrest specific protein 6) and its soluble tyrosine kinase receptor sAxl in sepsis and systemic inflammatory response syndromes" pps

... patient demographic data and diagnoses have been presented elsewhere [16] Pneumonia and urinary tract infections were common and also overrepresented in the severe sepsis and the sepsis groups Infected ... cell- and tissue-types may be the source of the sAxl in sepsis Both Axl and Mer have been shown to be shed under the influence of PMA and LPS [10,19] Gas6 correlates with IL-6, procalcitonin and ... Gas6, procalcitonin and number of failing organs, indicating that both Gas6 and sAxl are increased in inflammatory states Gas6 and sAxl are increased during organ failure, and Gas6 is increased...

Ngày tải lên: 13/08/2014, 21:21

5 238 0
Báo cáo y học: "Detailed analysis of 15q11-q14 sequence corrects errors and gaps in the public access sequence to fully reveal large segmental duplications at breakpoints for Prader-Willi, Angelman, and inv dup(15) syndromes" pdf

Báo cáo y học: "Detailed analysis of 15q11-q14 sequence corrects errors and gaps in the public access sequence to fully reveal large segmental duplications at breakpoints for Prader-Willi, Angelman, and inv dup(15) syndromes" pdf

... Makoff and Flomen R114.15 GCCTCC, respectively), S (ACGTGAGTTTGTTCAAGCAAGTC, CTTCTTCCCAGCATGTCACAGAT, and CCGCCTCCACAAGTT) and F (TGAAGTGTGGGTCATTTCCTAAGC, GGCAGACACAGCTGGGATAG, and CTACAGCCATGAGCTACTG) ... Copy number was also determined, using forward and reverse primers, and probes for segments H (TGAGTTTTCCACATGTACAGAACCA, GTCGGCTCCCAACTTCGT, and CTTTGGACACG- Genome Biology 2007, 8:R114 information ... both occur in segment T and are paralogous: between the central four haplotigs (5a, 5b, 3, and 4) and haplotigs 6a/6b on one side and haplotigs 2a/2b on the other (Figures and 6) To investigate...

Ngày tải lên: 14/08/2014, 07:21

16 384 0
Báo cáo y học: "Trace Elements, Heavy Metals and Vitamin Levels in Patients with Coronary Artery Diseas"

Báo cáo y học: "Trace Elements, Heavy Metals and Vitamin Levels in Patients with Coronary Artery Diseas"

... and serum cholesterol levels were not significantly different in patients with and without CAD (Table 1) Comparisons of the levels of the vitamins (retinol, tocopherol and cholecalciferol), and ... cholecalciferol levels and plasma renin activity, blood pressure, coronary artery calcification and prevalent cardiovascular disease (36-41) In conclusion, serum levels of trace elements and vitamins may ... levels and mortality Arch Intern Med 2002; 162: 2443-2449 31 Rock E, Winklhofer-Roob BM, Ribalta J, et al Vitamin A, vitamin E and carotenoid status and metabolism during ageing: functional and...

Ngày tải lên: 25/10/2012, 10:51

5 527 0
Tài liệu Bài 12: ICA by Nonlinear Decorrelation and Nonlinear PCA doc

Tài liệu Bài 12: ICA by Nonlinear Decorrelation and Nonlinear PCA doc

... W+NPCA6 W+NPCA7 12.9 −(W+NPCA3) −(W+NPCA4) Fig 12.6 W+NPCA2 W+NPCA8 261 W+NPCA9 The separated images using the nonlinear PCA criterion and learning rule CONCLUDING REMARKS AND REFERENCES The first ... values and have relatively low computational load Also batch versions of the recursive algorithm are derived in [236] CONCLUDING REMARKS AND REFERENCES −(W+NPCA1) W+NPCA5 W+NPCA6 W+NPCA7 12.9 ... DECORRELATION AND NONLINEAR PCA is a stochastic gradient algorithm and the other one a recursive least mean-square algorithm 12.1 NONLINEAR CORRELATIONS AND INDEPENDENCE The correlation between two random...

Ngày tải lên: 23/12/2013, 07:19

24 390 0
w