a world for your figures to live in

English Solutions for Engineering and Sciences Research Writing: A guide for English learners to publish in international journals ppt

English Solutions for Engineering and Sciences Research Writing: A guide for English learners to publish in international journals ppt

Ngày tải lên : 19/03/2014, 08:20
... studying mechanical engineering 1.5 Formal email style Always organize your formal emails into logical paragraphs Do not write emails line by line Most formal emails contain a three or four paragraph ... Chan-ho Park on campus He is a Hanyang alumni Let’s look at how the information is linked together in this paragraph example EXAMPLE A few years ago I had an unusual lunchtime at Hanyang I was ... called an independent clause; 주절) and subordinate clause (also called a dependent clause; 종속절) 2.4.1 Main (Independent) clause A main clause contains a subject and a verb that has a tense that expresses...
  • 186
  • 615
  • 0
A house I would like to live in pptx

A house I would like to live in pptx

Ngày tải lên : 22/07/2014, 04:20
... “roti prata”, “soup kambing” and other Malay food in a hawker centre at Hill Street Fadley’s parents are very hardworking They wake up early each morning to go to the market and to prepare the ... in a hawker centre at Hill Street Fadley’s parents are very hardworking They wake up early each morning to go to the market and to prepare the food Fadley’s brothers study in the neighboring ... secondary school They often join Fadley and me in our games His sister is pretty and has a winsome smile She is seldom at home as she works every day as a salesgirl in Metro Grand Fadley’s grandparents...
  • 9
  • 311
  • 0
No Safer Place in the World for Your Money - How to Make Sure All Your Deposits Are Protected by FDIC Insurance docx

No Safer Place in the World for Your Money - How to Make Sure All Your Deposits Are Protected by FDIC Insurance docx

Ngày tải lên : 15/03/2014, 10:20
... full each month A charge card may be a good option for people who are not planning to carry a balance and want to avoid interest charges,” said Creamean “However, if you use your charge card and ... different payment scenarios The calculator can also help you develop a plan for paying off your balance sooner Find it at www.federalreserve.gov/ creditcardcalculator A Spanish version is available at ... examples are letters falsely claiming to offer FDIC protection against investment losses in exchange for an up-front payment, and e-mails falsely saying that a consumer’s bank has failed and asking...
  • 8
  • 725
  • 0
Excess Cervical Cancer Mortality: A Marker for Low Access to Health Care in Poor Communities doc

Excess Cervical Cancer Mortality: A Marker for Low Access to Health Care in Poor Communities doc

Ngày tải lên : 28/03/2014, 23:20
... Births) (Alabama and Mississippi) Benton De Soto Marshall Alcorn Panola Franklin Lawrence Morgan Itawamba Lee Pontotoc Winston Marion Etowah Calhoun Chickasaw Monroe Walker Lamar Clay Webster ... Montgomery Attala Winston Talladega Tuscaloosa Noxubee Sharkey Shelby Issaquena Neshoba Scott Newton Autauga Lauderdale Lee Elmore Macon Dallas Montgomery Marengo Rankin Chambers Tallapoosa Perry Madison ... declining in many areas, including Appalachia To maintain and better integrate health services in rural areas, it will be important to include this group of providers Though the rural providers are...
  • 96
  • 283
  • 0
Báo cáo hóa học: " A Technique for Dominant Path Delay Estimation in an OFDM System and Its Application to Frame " docx

Báo cáo hóa học: " A Technique for Dominant Path Delay Estimation in an OFDM System and Its Application to Frame " docx

Ngày tải lên : 22/06/2014, 22:20
... domain sequence obtained from a frequency domain loading by a PN sequence (see (3)), its zero-lag autocorrelation magnitude is much larger than that of a nonzero lag The magnitude of lag-one autocorrelation, ... signal arriving through a delayed path may be larger than that of the earliest path In those cases, the estimate of the frame boundary may be shifted by a quantity equal to the delay of the dominant ... to thank S Rama Rao, Vice President and General Manager of Hellosoft India Pvt Ltd and Dr Y Yoganandam, Senior Technical Director of Hellosoft India Pvt Ltd for their constant encouragement and...
  • 8
  • 420
  • 0
YOUR ANZ YOUR WORLD ANNUAL REPORT 2010 we live in your world ANZ

YOUR ANZ YOUR WORLD ANNUAL REPORT 2010 we live in your world ANZ

Ngày tải lên : 04/07/2014, 22:01
... of a locally incorporated subsidiary in China, obtaining a qualifying full bank licence in Singapore and in principle approval for a foreign bank licence in India ANZ Annual Report 2010 Chairman’s ... growth in the region and to create value for our customers and for our shareholders Today, ANZ is the only Australian bank with a clearly articulated strategy to take advantage of Australia and ... GOVERNANCE (continued) CONTINUING EDUCATION ANZ Directors take part in a range of training and continuing education programs In addition to a formal induction program (see page 52), Directors also...
  • 115
  • 302
  • 0
the great work of your life  a guide for the journey to your true calli  stephen cope

the great work of your life a guide for the journey to your true calli stephen cope

Ngày tải lên : 05/07/2014, 07:34
... uncomprehending—but finally, enlightened Krishna’s first practical teaching to Arjuna is simple and direct: “Arjuna, look to your dharma.” Look to your dharma! And what is this dharma that can save Arjuna? ... dharma, imagined that for them to claim their dharma probably meant inventing an entirely new life Giving up their job selling insurance and moving to Paris to paint Quitting their job as a hospice ... landscape painting Alan is mastering the art of gardening and just, really, the art of living life as a naturalist My sister Arlie is mastering the to- meincomprehensible task of parenting an adolescent—but...
  • 192
  • 697
  • 0
Is Ho Chi Minh city a much better place to live in today ppt

Is Ho Chi Minh city a much better place to live in today ppt

Ngày tải lên : 21/07/2014, 20:20
... just earn enough money to be physical beings, not emotional or spiritual beings Its increasing crime and disorder also makes Ho Chi Minh City a worse place to live in today than ten years ago A number ... of transportation, tuition fees accommodation and a variety of private services such as tailoring, hairdressing, renovating, etc here are all much higher than the so-called standard legal income ... hoping to find out their ‘paradise’ For those who have been living in this city for a long time, more than 10 years for example, their ‘used -to- be paradise’ is getting worse and worse Sharing...
  • 7
  • 606
  • 0
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps

Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps

Ngày tải lên : 09/08/2014, 08:22
... Table Probes and primer sequences used Gene Primers and probes 11β-HSD1 Forward primer: AGGAAAGCTCATGGGAGGACTAG Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA ... CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC Reverse primer: GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα Forward primer: GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC ... Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: AAC TGG CAG CGG TTT TAT CAA CT Reverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA TGTGGTTA Probe: TGT GTG AGA TGT GCT TTC TGG TT C/EBPα Forward primer:...
  • 10
  • 438
  • 0
A framework for measuring the benefits that information technology brings to construction

A framework for measuring the benefits that information technology brings to construction

Ngày tải lên : 16/09/2015, 12:35
... such as market to book value ratio as a firm’s strategic performance indicators, and additional variables that can capture a firm’s potential future performance Using data from a large database ... environment for the private and public sectors to collaborate in exploring IT for a national competitive advantage To promote the integrated approach to construction, a few national IT initiatives have ... represents substantial financial investment for many organizations (Lin and Pervan, 2001) Organizations are continuing to invest sums of money in IT in anticipation of a material return on investment...
  • 149
  • 686
  • 0
Tài liệu Báo cáo khoa học: "A Tool for Multi-Word Expression Extraction in Modern Greek Using Syntactic Parsing" pdf

Tài liệu Báo cáo khoa học: "A Tool for Multi-Word Expression Extraction in Modern Greek Using Syntactic Parsing" pdf

Ngày tải lên : 22/02/2014, 02:20
... functionalities allowing users to create a database of manually validated MWEs from among the candidates displayed on the (parallel) concordancing interfaces The database can store either monolingual ... were automatically obtained through morphological generation; that is, the base word was combined with the appropriate suffixes, according to a given in ectional paradigm A number of 25 in ection ... Athina Michou 2007 Analyse syntaxique et traitement automatique du syntagme nominal grec moderne In Proceedings of TALN 2007, pages 203–212, Toulouse, France Angela Ralli 2005 Morphology Patakis,...
  • 4
  • 491
  • 0
Tài liệu Báo cáo khoa học: "SWAN – Scientific Writing AssistaNt A Tool for Helping Scholars to Write Reader-Friendly Manuscripts " docx

Tài liệu Báo cáo khoa học: "SWAN – Scientific Writing AssistaNt A Tool for Helping Scholars to Write Reader-Friendly Manuscripts " docx

Ngày tải lên : 22/02/2014, 03:20
... evidence remains anecdotal At this early stage, SWAN’s capabilities are narrow in scope.We continue to enhance the existing evaluation metrics And we are eager to include a new and already tested ... [Dale and Kilgarriff2010] R Dale and A Kilgarriff 2010 Text massaging for computational linguistics as a new shared task In Proc 6th Int Natural Language Generation Conference, Dublin, Ireland ... Kakkonen were supported cessing from Stanford, namely Stanford POS Tag- by the Academy of Finland The authors would like to thank ger (Toutanova et al., 2003) and Stanford Parser Arttu Viljakainen,...
  • 5
  • 349
  • 0
Tài liệu David prefers to live in the country rather than live in the city doc

Tài liệu David prefers to live in the country rather than live in the city doc

Ngày tải lên : 26/02/2014, 00:20
... *David prefers to live in the country rather than live in the city Hình thức ngữ pháp : Cấu trúc “ prefer to something rather than (do) something else” – ( thích làm việc việc kia) Chúng ta quan ... cụm câu: David prefers to live in the country rather than live in the city Tại câu lại dịch vậy? - “David” danh từ riêng (Proper Noun) tên người Giữ chức làm chủ ngữ câu - “prefers to live - thích ... …hơn “than” liên từ ( conjunction) có ngh a hơn(để diễn đạt so sánh) Ở “ rather than” dùng cấu trúc “ prefer to something rather than (do) something else” với ngh a “ là” "Prefer … rather than"-...
  • 5
  • 597
  • 0
Báo cáo khoa học: Activator-binding domains of the SWI ⁄ SNF chromatin remodeling complex characterized in vitro are required for its recruitment to promoters in vivo pot

Báo cáo khoa học: Activator-binding domains of the SWI ⁄ SNF chromatin remodeling complex characterized in vitro are required for its recruitment to promoters in vivo pot

Ngày tải lên : 07/03/2014, 00:20
... suggest that the predominant coactivating role of SWI ⁄ SNF may be at steps downstream of activator binding rather than as a facilitator of activator binding, although these roles are not mutually ... transcriptional activators in vitro [33] Recombinant activator interaction domains interact with activation domains in vitro using a two-step mechanism, where rapid ionic interaction with an unfolded activation ... activation domains are available to recruit target factors via two independent interactions Alternatively, a larger number of activator-binding domains could contribute to recruitment by increasing the...
  • 9
  • 539
  • 0
Báo cáo khoa học: Gene expression silencing with ‘specific’ small interfering RNA goes beyond specificity – a study of key parameters to take into account in the onset of small interfering RNA off-target effects potx

Báo cáo khoa học: Gene expression silencing with ‘specific’ small interfering RNA goes beyond specificity – a study of key parameters to take into account in the onset of small interfering RNA off-target effects potx

Ngày tải lên : 07/03/2014, 05:20
... 5¢-AGGGCATCCGA GAATTCCTT-3¢), LAMP2 (forward, 5¢-TCAGCATTGC AAATAACAATCTCA-3¢; reverse, 5¢-CAGTCTGCTCT TTGTTGCACATATAA-3¢), CTGF (forward, 5¢-CA AGCTGCCCGGGAAAT-3¢; reverse, 5¢-GGACCAGGCA GTTGGCTCTA-3¢), ... (forward, 5¢-GGATCAAGGC GGAGAGGAA-3¢; reverse, 5¢-TCCAGCCGGGCGATT-3¢), PLAU (forward, 5¢-CTGTGACCAGCACTGTCT CAGTTT-3¢; reverse, 5¢-CCCAGTGAGGATTGGATGA ACTA-3¢), SPARC (forward, 5¢-GAGACCTGTGACCT ... GGACAATG-3¢; reverse, 5¢-GGAAGGAGTGGATTTAG ATCACAAGA-3¢), TGFBR2 (forward, 5¢-TGGACCCT ACTCTGTCTGTGGAT-3¢; reverse, 5¢-TTCTGGAGC CATGTATCTTGCA-3¢) and TBP ⁄ TFIID (forward, 5¢-CCTCACAGGTCAAAGGTTTACAGTAC-3¢;...
  • 16
  • 494
  • 0
Báo cáo khoa học: "A Corpus for Modeling Morpho-Syntactic Agreement in Arabic: Gender, Number and Rationality" docx

Báo cáo khoa học: "A Corpus for Modeling Morpho-Syntactic Agreement in Arabic: Gender, Number and Rationality" docx

Ngày tải lên : 07/03/2014, 22:20
... highlighted as a challenge and annotators are asked to think of different contexts for the word in question 4.4 Inter-Annotator Agreement We computed inter-annotator agreement (IAA) over a random set ... annotations in the PATB The overall high scores for IAA suggest that the task is not particularly hard for humans to perform, and that disambiguating information is crucial Points of disagreement ... Farghaly and Karine Megerdoomian, editors, COLING 2004 Computational Approaches to Arabic Script-based Languages, pages 15–22, Geneva, Switzerland, August 28th COLING Imad Al-Sughaiyer and Ibrahim Al-Kharashi...
  • 6
  • 378
  • 0
Báo cáo khoa học: Isolation of a putative peroxidase, a target for factors controlling foot-formation in the coelenterate hydra docx

Báo cáo khoa học: Isolation of a putative peroxidase, a target for factors controlling foot-formation in the coelenterate hydra docx

Ngày tải lên : 08/03/2014, 10:20
... Bradford (Bio-Rad protein assay) using bovine serum albumin as standard Determination of the peroxidase activity The peroxidase activity was measured in a solution containing 0.1% (w/v) 2,2¢-azino-bis-(3-ethylbenzthiazoline-6-sulfonic ... (Stratagene) The vector was packaged with the Gigapack II packaging extract (Stratagene) The library contained 0.8 · 106 independent plaques and was amplified once As template for PCR the cDNA was ... (fm), and granules without diaminobenzidine-staining as a control (D) Scale bars are mm in (A) , 20 lm in (B), and 1.5 lm in (C) and (D) considered to be aged cells, and they contain less stained...
  • 10
  • 389
  • 1
Simply Put: A guide for creating easy-to-understand materials ppt

Simply Put: A guide for creating easy-to-understand materials ppt

Ngày tải lên : 14/03/2014, 20:20
... provides information about policy, legislation, and programs related to literacy Plain Language Association International http://www.plainlanguagenetwork.org/ Plain Language Association International ... complicated scientific and technical information into communication materials your audiences can relate to and understand The guide provides practical ways to organize information and use language and ... ways to see how a “plain language” approach can improve a document is to look at examples of documents before and after they were edited into plain language For before and after examples go to: ...
  • 44
  • 349
  • 0

Xem thêm