a wide spectrum in the severity of familial hypercholesterolemia

Báo cáo y học: "Complement C3 serum levels in anorexia nervosa: a potential biomarker for the severity of disease" pdf

Báo cáo y học: "Complement C3 serum levels in anorexia nervosa: a potential biomarker for the severity of disease" pdf

... proteins, indicating increased PBMC activity in these patients [20] Thus, activated PBMCs and neutrophils may further contribute to alterations of C 3a and C 5a levels bypassing the traditional complement ... depending on the length of their hospitalization Eight patients (57%) had multiple blood samples and were included in the longitudinal analysis As the patients became medically stabilized during their ... complement activation cascade There are few reports on complement activation in anorexia nervosa available in the peer-reviewed literature, dating back to the 1970s and 1980s [21-23] Wyatt et al published...

Ngày tải lên: 09/08/2014, 01:21

6 441 0
Focus - A simplicity manifesto in the Age of Distraction

Focus - A simplicity manifesto in the Age of Distraction

... inspiration in what others have done, you get ideas, you gather the raw materials for creating But consuming and communicating aren’t creating They aid creating, they lay the groundwork, but at some point ... what are you afraid of? Then shine a light on these fears with actual facts — what harm has actually been caused so far? Try to a short test — an hour, a day, a few days, a week — and see what ... were insulted or indignant, either feeling like I was insulting their way of doing things, or that I was some kind of prima donna or “diva” for not wanting to be available through email Interesting:...

Ngày tải lên: 05/01/2014, 15:25

121 553 1
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx

Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx

... SG a Os an ali th A 4B T7 UG 4F2 A na ia al th a an A na a ia alia na al an th ali A th A 4C 1A 4D T7 4E T7 th na alia A th ana hali B1 ana ali A th 1A 1A T9 UG hali A t 1B C1 T9 T91 UG UG A ... vinifera ax T84 A thaliana UGT76F1 UG a lian tha ali ari icum th a 2F rag a 1A lian GT na copers Fa 6A tha ia an T8 H S ly S3950 A al th ali 1A 76E UGT D1 th na alia lor ico a b an TS ali th A A ... B1 A th aliana CaU GT1 C ro seu UG s T7 1C UG 1A T7 th UG alia 1D T8 na UG A 8A T7 th 2E ali A 2A an th a th al ia ali na an a thalia 1A th alia na na 6B1 A UG T76 C UGT7 A1 CAO69089 V vinifera...

Ngày tải lên: 28/03/2014, 23:20

11 661 0
Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

Báo cáo khoa học: Inactive forms of the catalytic subunit of protein kinase A are expressed in the brain of higher primates potx

... TGCCATGAAGATCTTAGA TGAGCAGTACTACGCCATGA GTAGCCCTGCTGGTCAATGA TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CCTAATGCCCACCAATCCA (VI) TTCCGTAGAAGGTCCTTGAG (VII) TTCCGTAGAAGGTCCTTGAG (VII) CTAATCTATGAAATGGCAG ... splice variants (Pfu Ultra system; Stratagene) Upper primer 5¢-CACCGCCG CCACCATGGGATTGTCACGCAAATCATCAGATGC ATCT-3¢ and lower primer 5¢-TTAAAATTCACCA AATTCTTTTGCACATT-3¢ yielded Cb3ab and Cb3abD4, ... Supplementary material The following supplementary material is available online: Fig S1 Comparison of human and Rhesus monkey PKA Cb amino acid sequence This material is available as part of the online...

Ngày tải lên: 30/03/2014, 04:20

13 344 0
Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

Báo cáo khoa học: Acylation of lysophosphatidylcholine plays a key role in the response of monocytes to lipopolysaccharide ppt

... (Kirkegaard and Perry, Gaithersburgh, MD, USA) per well The plate was incubated in the dark for 20 and the reaction stopped by the addition of 50 lL of 0.5 M sulfuric acid The plate was read on a Labsystems ... confirms that IFN-c can increase the activity of an enzyme, LPCAT, that participates in the rapid turnover of PtdCho Lysophospholipid acyltransferases maintain membrane lipid composition and the asymmetrical ... and one for TNF -a The level of U 1A mRNA was similar in all samples as shown in Fig 4A This indicated equal extraction efficiency and that SK&F 98625 was not a general transcription inhibitor There...

Ngày tải lên: 31/03/2014, 01:20

7 322 0
báo cáo hóa học:" Research Article Entire Solutions for a Quasilinear Problem in the Presence of Sublinear and Super-Linear Terms" potx

báo cáo hóa học:" Research Article Entire Solutions for a Quasilinear Problem in the Presence of Sublinear and Super-Linear Terms" potx

... Boundary Value Problems The class of problems 1.1 appears in many nonlinear phenomena, for instance, in the theory of quasiregular and quasiconformal mappings 1–3 , in the generalized reaction-diffusion ... no 2, pp 498–505, 1996 13 A V Lair and A W Shaker, “Classical and weak solutions of a singular semilinear elliptic problem,” Journal of Mathematical Analysis and Applications, vol 211, no 2, pp ... Methods & Applications, vol 10, no 1, pp 55–64, 1986 12 A V Lair and A W Shaker, “Entire solution of a singular semilinear elliptic problem,” Journal of Mathematical Analysis and Applications,...

Ngày tải lên: 21/06/2014, 20:20

16 439 0
Báo cáo lâm nghiệp: "Results of a phenological study of the tree layer of a mixed stand in the region of the Drahanská vrchovina Upland" ppt

Báo cáo lâm nghiệp: "Results of a phenological study of the tree layer of a mixed stand in the region of the Drahanská vrchovina Upland" ppt

... times a week In the summer and autumn season, the observations are carried out once a week The ordinal number of a day from the beginning of the calendar year was assigned to the date of particular ... herbs can also occur Phenological data are a certain expression of the climate character of a given region Thus, they can contribute to assess the variability of weather and also to evaluate the ... leaf area is terminated by the autumn phenological stage (autumn yellowing of leaves) According to budbreak 10% beginning of foliage formation 10% beginning of foliage formation 50% beginning of...

Ngày tải lên: 07/08/2014, 03:22

12 386 0
Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx

Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx

... can be anticipated that several clinical trials exploring this approach will be reported in the near future Competing interests Conclusion The available data in animal models and initial data ... inhibiting the migration of cells that are able to produce an array of proinflammatory cytokines at the site of inflammation The identification of the best targets will be the subject of future research ... 95 Arthritis Research & Therapy Vol No Haringman and Tak The data from studies with chemokine antagonists in humans are at present not very comprehensive However, the initial data are promising...

Ngày tải lên: 09/08/2014, 01:23

5 460 0
Báo cáo y học: "Direct interaction of immunoglobulins with synovial fibroblasts: a missing link in the pathogenesis of rheumatoid arthritis" potx

Báo cáo y học: "Direct interaction of immunoglobulins with synovial fibroblasts: a missing link in the pathogenesis of rheumatoid arthritis" potx

... Available online http://arthritis-research.com/content/7/1/44 cellular activation (also known as transformation), that leads to alteration in their apoptotic response, the attachment of these ... destruction Although a number of molecular pathways have been identified that contribute to the stable activation of RASFs, the precise cause and nature of this activation, as well as its relevance and ... consequences, are matters of debate The present data indicate very clearly that stable alterations in the fibroblasts themselves are indispensable for (auto)antibodies to exert their effects on IL-16 (and...

Ngày tải lên: 09/08/2014, 06:22

3 223 0
Báo cáo khoa học: "SemiPro-inflammatory cytokines play a key role in the development of radiotherapy-induced gastrointestinal mucositis" pptx

Báo cáo khoa học: "SemiPro-inflammatory cytokines play a key role in the development of radiotherapy-induced gastrointestinal mucositis" pptx

... 5’-GTGCATCATCGCTGTTCATACA TNF Forward: 5’-GTGATCGGTCCCAACAAG-3’ Results 71 X66539 Reverse: 5’-AGGGTCTGGGCCATGGAA-3’ b actin Forward: 5’-AGGCCAACCGTGAAAAGATG-3’ 101 NM_031144 Reverse: 5’-ACCAGAGGCATACAGGGACAA-3’ ... weeks of radiotherapy Staining was variable between the basal and apical regions of the crypts and did not significantly change of the course of radiotherapy (Data not shown) IL-6 IL-6 staining was ... that had received no radiotherapy There was an increase in protein expression of TNF after radiotherapy, particularly after 22.5 Gy and 30 Gy as indicated by the arrow, although the staining was...

Ngày tải lên: 09/08/2014, 08:22

8 335 0
Báo cáo y học: "Accelerated cellular senescence in degenerate intervertebral discs: a possible role in the pathogenesis of intervertebral disc degeneration" ppt

Báo cáo y học: "Accelerated cellular senescence in degenerate intervertebral discs: a possible role in the pathogenesis of intervertebral disc degeneration" ppt

... FAM – AGG GGT CCT GGC TGC CTT CCT CTT C – TAMRA 3' 5' GAC AAA TCA TCT TCA TCA CCA CCA C 3' 99.77% ADAMTS 5' GGA CCT ACC ACG AAA GCA GAT C 3' 5' FAM – CCC AGG ACA GAC CTA CGA TGC CAC C – TAMRA ... for each passage, and cumulative population doublings were calculated At each passage, an aliquot of approximately × 106 cells was taken for analysis of MTL, and regression analysis and Spearman ... PDAR PDAR PDAR 99.65% P16INK 4a 5' GGC TCT ACA CAA GCT TCC TTT CC 3' 5' FAM – CCC CCA CCC TGG CTC TGA CCA – TAMRA 5' TCA TGA CCT GCC AGA GAG AAC A 3' 99.22% MMP-13 5' CCC CAG GCA TCA CCA TTC AAG...

Ngày tải lên: 09/08/2014, 10:20

12 618 0
báo cáo khoa học: "Segregational patterns of a chromosome insertion in the progeny of twin chimeric bulls" potx

báo cáo khoa học: "Segregational patterns of a chromosome insertion in the progeny of twin chimeric bulls" potx

... as against cells with a normal karyotype (M et al., 1980) ORAES Because of the chimeric nature of the twins and the rarity of the insertion in the population, it was concluded that, in terms of ... vascular anastomosis taking place after the migration of the primordial germ cells to the site of the primitive gonad had finished, a mechanism which has been previously suggested to explain the ... 100 fetal calf serum, p 100 phytohemaglutinin M (Difco), 100 LU of penicillin and 100 mg/ml of streptomycin The metaphases were conventionally stained in Giemsa and 15 analysed for each animal III...

Ngày tải lên: 09/08/2014, 22:22

5 319 0
Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps

Báo cáo y học: "Prior exposure to an attenuated Listeria vaccine does not reduce immunogenicity: pre-clinical assessment of the efficacy of a Listeria vaccine in the induction of immune responses against HIV" pps

... demonstrated that oral inoculation of live attenuated Lmdd and i.v D-ala administration was safe and well tolerated in rhesus macaques Liver toxicity secondary to bacterial invasion can be a serious ... monkeys, indicating limited bacterial invasion into the liver, or complete clearance, by days after boost vaccination Our pilot results warrant the testing of attenuated Lm vectors as part of an orally ... shown in parentheses for each group All Lmdd-gag vaccinations were preceded by oral administration of saturated sodium bicarbonate D-ala (640 mg/kg) was co-administered intravenously before and after...

Ngày tải lên: 11/08/2014, 08:21

7 394 0
báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx

báo cáo khoa học: " The transcription factor PHR1 plays a key role in the regulation of sulfate shoot-to-root flux upon phosphate starvation in Arabidopsis" potx

... 10:78 Tomatsu H, Takano J, Takahashi H, Watanabe-Takahashi A, Shibagaki N, Fujiwara T: An Arabidopsis thaliana high-affinity molybdate transporter required for efficient uptake of molybdate from ... role in sulfate translocation within developing seeds Plant Physiol 2010, 154:913-926 Kataoka T, Watanabe-Takahashi A, Hayashi N, Ohnishi M, Mimura T, Buchner P, Hawkesford MJ, Yamaya T, Takahashi ... M, Hawkesford MJ, Saito K: The roles of three functional sulphate transporters involved in uptake and translocation of sulphate in Arabidopsis thaliana Plant J 2000, 23:171-182 Kataoka T, Hayashi...

Ngày tải lên: 11/08/2014, 11:21

10 427 0
Báo cáo y học: " Use of a Javid™ shunt in the management of axillary artery injury as a complication of fracture of the surgical neck of the humerus: a case report" ppsx

Báo cáo y học: " Use of a Javid™ shunt in the management of axillary artery injury as a complication of fracture of the surgical neck of the humerus: a case report" ppsx

... control of the subclavian artery above the clavicle (Fig 3A) Simultaneous exposure of the brachial artery in the antecubital fossa was performed and a size Fogarty embolectomy catheter passed distally ... limb ischaemia [4,5,9] Pseudoaneurysm formation of the axillary artery is rare following blunt and penetrating trauma to the shoulder, often presenting late as a pulsatile mass rather than acute ... a Javid™ shunt, which allowed safe internal fixation of the fracture before bypass grafting The insertion of the Javid™ shunt served to confirm the viability of the limb and adequacy of distal...

Ngày tải lên: 11/08/2014, 21:22

4 342 0
Báo cáo y học: "Soluble IL-18 receptor complex: a new star in the firmament of rheumatoid arthritis diagnosis" pptx

Báo cáo y học: "Soluble IL-18 receptor complex: a new star in the firmament of rheumatoid arthritis diagnosis" pptx

... has no competing interests Published: 27 April 2011 References Takei S, Hoshino T, Matsunaga K, Sakazaki Y, Sawada M, Oda H, Takenaka S-I, Imaoka H, Kinoshita T, Honda S, Ida S, Fukuda T -A, Aizawa ... activity; the activation and release of IL-18 by the in ammasome as a marker of innate immunity; and the alternatively spliced soluble IL-18Rβ, which is mainly expressed in the lymphoid organs and ... the diagnosis of RA The soluble IL-18Rα complex as a biomarker may capture the complexity of the in ammatory process: the shedding of membrane IL-18Rα as a marker of enhanced proteolytic activity;...

Ngày tải lên: 12/08/2014, 15:22

3 294 0
Báo cáo khoa học: "Pro/con clinical debate: Steroids are a key component in the treatment of SARS" pps

Báo cáo khoa học: "Pro/con clinical debate: Steroids are a key component in the treatment of SARS" pps

... regarding the use of steroids in the treatment of SARS remain unanswered, including the efficacy of this treatment, the appropriate timing of initiation of treatment, and the dose and duration of therapy ... treatment of ARDS and larger trials are in progress The appropriate timing of steroid therapy needs to be clarified Steroids have been advocated for the late immunemediated phase of the disease, although ... Obias-Manno D, Barker AH, Arensberg D, Baker A, Friedman L, Greene HL, Huther ML, and the CAST investigators: Mortality and morbidity in patients receiving encainide, flecainide, or placebo The...

Ngày tải lên: 12/08/2014, 20:20

3 355 0
a basic course in the theory of interest and derivatives markets

a basic course in the theory of interest and derivatives markets

... rate of interest in is the ratio of the amount of interest earned during the period to the amount of principal invested at the beginning of the period Note that i1 = i = a( 1) − and for any accumulation ... his account He then reinvests the total money in a new savings account offering the same rate Who has the greater accumulated value at the end of two years? Solution John’s accumulated value at the ... make a deposit of $100 at time t = A year later, you make a withdrawal of $50 Assume annual simple interest rate of 10%, what is the accumulated value at time t = years? Solution The balance in...

Ngày tải lên: 05/11/2014, 13:29

745 1K 0
A STUDY ON GRADE 10 TH STUDENTS’ PERCEPTIONS TOWARDS LEARNING TO READ ENGLISH AT A HIGH SCHOOL IN THE NORTH OF VIETNAM

A STUDY ON GRADE 10 TH STUDENTS’ PERCEPTIONS TOWARDS LEARNING TO READ ENGLISH AT A HIGH SCHOOL IN THE NORTH OF VIETNAM

... an approach to teaching and learning reading that uses reading materials that are understandable and meaningful to the learner in order for learners to be able to read large amounts The aim of ... selected reasons for poor reading habits The importance of reading in learning process as well as the role of pleasure reading habits and reading attitudes towards reading and others skills has been ... a large amount of reading Sharing the same opinion, Richards & Schmidt (2002, p 193–194) stated that ER “means reading in quantity and in order to gain a general understanding of what is read...

Ngày tải lên: 10/07/2015, 14:50

63 588 1
A new direction in the study of the orientation number of a graph

A new direction in the study of the orientation number of a graph

... ie aj → B ∗ Th e n d( b∗ , aj ) ≤ fo r a ll b∗ ∈ B ∗ im p lie s B ∗ → a; a n d fo r a ll al ∈ A \ {aj }, d( al , aj ) ≤ im p lie s al → a Th is m e a n s t h a t A = {aj } a n d A = A \ {aj ... h a p t e r b y e xa m in in g t h e family o f g r a p h s ( r a t h e r t h a n ju s t a particular g r a p h ) o b t a in e d b y a d d in g p e d g e s b e t we e n Kp a n d Cp in a n a ... o t a c o -p a ir Fo r e a c h bi ∈ B, le t Si = O( bi ) ∩ A W e a ls o le t A = {ai |ai → a in F } a n d A = A \ A L ike wis e , B = {bj |bj → b in F }, B = B \ B , A = {ai |b → in F } a n...

Ngày tải lên: 12/09/2015, 21:07

226 350 0
w