... Geographic Information system (GIS) is any system integrates hardware, software, and data for capturing, managing, analyzing, and displaying all forms of geographically referenced information ... operating system - Easy to manage, update database: Database is located at dedicated server that managers can maintain and update it easily - Quick delivery: web- based model make it portable ... higher performance Most of web applications today use Relational Database Management System (RDBMS) using Structure Query Language (SQL) to store and manipulate data logic There are many available...
Ngày tải lên: 27/10/2012, 16:40
... operator, the page author, and information appearance (e.g., contact address, privacy policy, volume of advertisements, and images) are automatically analyzed and stored in the standard format ... Evaluative Information The extraction and classification of evaluative information from texts are important tasks with many applications and they have been actively studied recently (Pang and ... of information credibility, it appears important to deal with a wide variety of evaluative information including such implicit evaluative expressions (Nakagawa et al., 2008) A corpus annotated...
Ngày tải lên: 17/03/2014, 02:20
Báo cáo y học: "ExpressionPlot: a web-based framework for analysis of RNA-Seq and microarray gene expression data" doc
... [http://www.ebi.ac.uk/ena/ data/view/ERP000619] 28 Affymetrix - Sample Data, Exon 1.0 ST Array Dataset [http://www affymetrix.com/support/technical/sample_data/exon_array_data.affx] 29 Akira S, Takeda K: ... data Brad A Friedman1,2,3* and Tom Maniatis4 Abstract RNA-Seq and microarray platforms have emerged as important tools for detecting changes in gene expression and RNA processing in biological ... of the Barres Lab (Stanford), Myers Lab (HudsonAlpha Institute), Ravits Lab (Benaroya Institute) and Maniatis Lab (Harvard/Columbia) for providing data and/or user feedback This work was supported...
Ngày tải lên: 09/08/2014, 23:20
a system for managing experiments in data mining
... forward and can be easily understood The main entities identified are rawdata, ruledata, testdata, experimentdata Raw data contains all information about the data and attributes of the dataset ... database is shown in Appendix A; only the parameters change accordingly if it is a raw data set or rule dataset Once the rules are generated for particular dataset, the dataset doesn’t appear ... datasets, and we might perform many experiments on the same dataset It is necessary to manage the datasets accordingly with respect to the raw data, learned data, test data etc Management of experiments...
Ngày tải lên: 30/10/2014, 20:01
A Fast File System for UNIX
... fragments and a single unused fragment This remaining fragment can be allocated to another file as needed Space is allocated to a file when a program does a write system call Each time data is written ... the allocated space The problem with expanding a file one fragment at a a time is that data may be copied many times as a fragmented block expands to a full block Fragment reallocation can be minimized ... space for a small amount of data, the remaining fragments of the block are made available for allocation to other files As an example consider an 11000 byte file stored on a 4096/1024 byte file system...
Ngày tải lên: 12/09/2012, 14:16
A NEW CLASSIFICATION SYSTEM FOR URBAN STORMWATER POLLUTANT LOADING: A CASE STUDY IN THE SANTA MONICA BAY AREA
... provides practical information with reasonable accuracy, which can be used for environmental planning and management Open land use corresponds to low pollutant loads for all water quality parameters ... loading areas, which were classified as public land use in the SCAG data and USGS classification system Recreational facilities including parks were also classified as low pollutant loading areas, ... pollutant loads per unit pixel and unit rainfall for each water quality parameter i and α is a normalization factor that depends on units and conversion factors Table Runoff coefficient and EMCs for...
Ngày tải lên: 05/09/2013, 09:08
Tài liệu A Knowledge Management System for ERP Implementation pdf
... cooperative working platform, knowledge transfer platform, individual RESEARCH PAPER KM platform, organizational KM platform and consulting platform The interplay of these five platforms can speed ... Lastly, a KM system is proposed that consists of cooperative working platform, consulting platform, individual KM platform, organizational KM platform, and knowledge transfer platform This system ... (2006) Yuan Li et al Syst Res RESEARCH PAPER Cooperative Working Platform Individual Organizational KM Consulting Platform Platform KM Platform Knowledge Transfer Platform Figure The platform structure...
Ngày tải lên: 16/01/2014, 16:33
Tài liệu Knowledge Management in OSS—an Enterprise Information System for the Telecommunications Industry doc
... between data, information and knowledge: Data are known facts that can be recorded and that have implicit meaning (Elmasri and Navathe, 2004) Information is data placed in a meaningful and useful ... Planning Administration Management & RSS Network resource Operation management Customer information management basic information management Customer service information management SSS User Management ... resource planning cases and the accumulated network resource management strategy form the major human knowledge Database, data marts and data warehouses about services and products represent the major...
Ngày tải lên: 24/01/2014, 00:20
Tài liệu Báo cáo khoa học: "GEMINI: A NATURAL LANGUAGE SYSTEM FOR SPOKEN-LANGUAGE UNDERSTANDING*" doc
... is that when they are formulated loosely, as in the previous paragraph, they appear to conflict In particular, in ( 2a) , Right Association seems to call for the parse that makes for Mary a modifier ... Systems, ed P Jacobs, Lawrence Erlbaum Associates, Hillsdale, NJ, pp 13-33 Kameyama, M (1992) "The Syntax and Semantics of the Japanese Language Engine", forthcoming In Mazuka, R., and N Nagai, ... the fact that every lexical item has a semantics associated with it Table contains average edge counts and parse timing statistics for the 5875-utterance training set Many systems (Carbonell and...
Ngày tải lên: 20/02/2014, 21:20
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA TCATCTTTTAAACTTTGGGCGAAGGCGTTT TTTTCTCGAGAAAGATGCCGATTTGGGCGC GGGGCTCGAGGTTTTATATTTGTTGTAAAA ATATTATATATATATATAGGGTCGTATATA AAATTATAGAAAGCAGTAGA TAAAACAATG CTTCGAAGAATATACTAAAAAATGAGCAGG ... GCCCGTCGACATATTATATATATATATAGG CCCGCTCGAGTCTTAGAATTATTGAGAACG GCCCGGATCCTGATAGTAATAGAATCCAAA CCCCGAATTCAAATTATAGAAAGCAGTAGA AAGGCTCGAGAGATCTGTTTAGCTTGCCTC AAAAGTCGACGAGCTCGTTTTCGACACTGG TTTTGTCGACATGGCGCAACACGATGAAGC ... TTTTGTCGACATGGCGCAACACGATGAAGC CGTAGACAAC GGGGGGATCCTTACATAAGCGTACAACAAA CACTATTTGATTTCGGCGCCTGAGCATCA TTTAGCTTTTT ATCCAAAGTTTAGCCGATGACCCAAGCCAA TTGGCTTGGGTCATCGGCTAAACTTTGGAT AAACGCCTTCGCCCAAAGTTTAAAAGATGA...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Identification of sodium salicylate as an hsp inducer using a simple screening system for stress response modulators in mammalian cells pptx
... Hatayama, T (1999) Molecular cloning, expression and localization of human 105 kDa heat shock protein, Hsp105 Biochim Biophys Acta 1444, 138–142 16 Yasuda, K., Nakai, A. , Hatayama, T & Nagata, ... such as Hsp10 5a and Hsp70 in various mammalian cells Enhancement of thermoresistance of cells by SA Upon exposure to a sublethal heat treatment, mammalian cells acquire transient resistance to a ... neutral red, and fixed with 1% formaldehyde containing 1% CaCl2 for The dye incorporated into viable cells was extracted with 50% ethanol containing 1% acetic acid, and absorbance at 540 nm was measured...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo khoa học: " a Web-based Tool for NLP-Assisted Text Annotation" pdf
... Conference on Natural Language Learning, pages 152–164 Association for Computational Linguistics Hamish Cunningham, Diana Maynard, Kalina Bontcheva, Valentin Tablan, Niraj Aswani, Ian Roberts, Genevieve ... annotations Finally, annotators can attach free-form text notes to any annotation In addition to information extraction tasks, these annotation primitives allow BRAT to be configured for use in various ... (Kim et al., 2011) Information Extraction (IE) tasks (Figure 2) Additional aspects of annotations can be marked using attributes, binary or multi-valued flags that can be added to other annotations...
Ngày tải lên: 17/03/2014, 22:20
ENVIRONMENTAL INFORMATION SYSTEM FOR ANALYSIS AND FORECAST OF AIR POLLUTION (APPLICATION TO SANTIAGO DE CHILE) pdf
... the urban area of Santiago This area was chosen in a first step because that is the area for which data is available In a second phase, for photochemical simulations probably a larger domain would ... them with an area of km² After this, it is necessary to provide three kinds of data for each grid: static data (elevation), slowly varying data (land use) and rapid varying data (emission and meteorological ... percentage of water, meadows, forest, suburban and urban area were computed As we mentioned before, the rapid varying data includes emissions and meteorological information Emission data of nitrogen...
Ngày tải lên: 23/03/2014, 04:20
Lore: A Database Management System for Semistructured Data ppt
... standard operators such as Scan and Join, some take an original avor For example, Scan may take as argument a general path expression, and therefore may entail complex searches in the database ... unique path expressions As an example, Figure 10 is a screen snapshot of the Java presentation of a DataGuide This DataGuide summarizes an existing database for Stanford's Database Group, similar ... and system implementation we are grateful to alphabetically Kevin Haas, Matt Jacobsen, Tirthankar Lahiri, Qingshan Luo, Svetlozar Nestorov, Anand Rajaraman, Hugo Rivero, Michael Rys, and Takeshi...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo khoa học: "Joint Learning of a Dual SMT System for Paraphrase Generation" pptx
... criteria in paraphrase generation: adequacy measuring the semantic equivalency and paraphrase rate measuring the surface dissimilarity As they are incompatible (Zhao and Wang, 2010), the question arises ... evaluations of paraphrase quality and rate tend to be incompatible To address the above problems, we propose a metric for tuning parameters and evaluating the quality of each candidate paraphrase ... Dolan 2011 Collecting highly parallel data for paraphrase evaluation In ACL, pages 190–200 David Chiang 2007 Hierarchical phrase-based translation Computational Linguistics, 33(2):201–228 Pablo...
Ngày tải lên: 23/03/2014, 14:20
Research " A WEB-APPLICATION TOOL FOR MANUFACTURING SYSTEMS STRATEGIC MANAG AND COMPETITIVE PERFORMANCE MONITORIN " pptx
Ngày tải lên: 30/03/2014, 01:20
Báo cáo khoa học: "A Subcategorization Acquisition System for French Verbs" doc
... on Language Resources and Evaluation, volume IV, pages 1351–1357, Las Palmas de Gran Canaria, Spain Mihai Surdeanu, Sanda M Harabagiu, John Williams, and Paul Aarseth 2003 Using Predicate-Argument ... lexicon that contains partial subcategorization information (Sagot et al., 2006), while Dicovalence is a manually built valency dictionnary based on the pronominal approach (van den Eynde and Blanche-Benveniste, ... For more details of the lexicon and its format, see (Messiant et al., 2008) 3.3 Gold Standard Direct evaluation of subcategorization acquisition performance against a gold standard based on a...
Ngày tải lên: 31/03/2014, 00:20
báo cáo hóa học: "Introducing a feedback training system for guided home rehabilitation" potx
... measured force values For all parameters, the mean values as well as the variances were calculated For evaluating the differences in the parameters among different groups, analysis of variance (double-sided ... suitable for home rehabilitation training This is true for many other approaches as well [32-36] Page of 11 We therefore aimed to develop an easy to use, cheap and mobile training system that allows ... location of greatest stress a resistance strain gauge from Vishay [41] is applied to measure the bending of the material as a consequence of an applied force Strain gauges change their electrical...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo hóa học: "Occupational medical prophylaxis for the musculoskeletal system: A function-oriented system for physical examination of the locomotor system in occupational medicine (fokus(C))" potx
... years of practical experience and the limited time allowed for occupational medical examinations speak for a systematic subdivision of the physical examination into a screening phase and, based on ... into account the fact that occupational medical prophylaxis does not aim primarily at producing a therapeutic indication but at prevention From the large number of available validated tests for ... screening in this form have revealed no abnormalities, no functional disorders of relevance for occupational medicine are present • the forearm in pronation and supination, • ulnar and radial duction...
Ngày tải lên: 20/06/2014, 00:20