... SWM, Jalan R: Role of ammonia and inflammation in minimal hepatic encephalopathy Metab Brain Dis 2007, 22:125-138 Arias JL, Aller MA, Sanchez-Patan F, Arias J: The inflammatory bases of hepatic ... 148 Palma MD, Aller MA, Vara F, Nava MP, Garcia C, Arias-Diaz J, Balibrea JL, Arias J: Portal hypertension produces an evolutive hepatointestinal pro- and anti-inflammatory response in the rat ... Duran HJ, Llamas MA, Arias J: Evolutive types of prehepatic portal hypertension of the rat An Med Interna 2002, 19:341-351 Aller MA, Nava MP, Duran M, Alvarez E, Arias JL, Sánchez-Patan F, Llamas...
Ngày tải lên: 13/08/2014, 16:21
... draws in not only China, Japan and Korea, but Americans, Russians and Europeans; ASEAN-plus-three summits are clubbier, involving only regional rivals China, Japan and Korea A new East Asian ... the African Union and the various talking-shops of Latin America, the Arab world and Asia, as well as from steadying alliances, such as NATO As a result, there has been no return to the disastrous ... excludes America but brings in India and Australia, among others; Americans naturally prefer to boost the AsiaPacific Economic Co-operation forum (APEC) Meanwhile Russia, China and their Central Asian...
Ngày tải lên: 30/03/2017, 14:17
Debating the Best Way to Learn a Language doc
... years, Botswana has used its wealth from diamond exports to finance universal primary education and to create a skills base for its growing economy And that's the VOA Special English Education Report ... further research is warranted And it may be, for example, that a combination of classroom and immersion might be best But we don't know that." And that's the VOA Special English Education Report, ... Tedder Tomato's Genetic Secrets Are Peeled Away This is the VOA Special English Agriculture Report Scientists have made a genetic map of the tomato Tomatoes are second only to potatoes as the world's...
Ngày tải lên: 27/06/2014, 09:20
She cannot find a way to pay for the tuition pot
... thể” “be capable of + V_ing” Ví dụ: “I can learn English well” = “I am able to learn English well” = “I am capable of learning English well” - Tơi có khả học giỏi tiếng Anh - “cannot” = “can’t” – ... (modal verb) có ngh a có thể, có khả Cấu trúc “Modal Verb (can, could, should, may, might… + V _nguyên thể” Ngồi để diễn đạt khả làm ta dùng “be able to” “be capable of” với cấu trúc sau: “be able ... từ đó) She cannot find a way to pay for the tuition 2 Các bạn di chuột vào cụm từ để biết chức cụm câu: She cannot find a way to pay for the tuition 3 Tại câu lại dịch vậy? - “can” – động từ...
Ngày tải lên: 25/03/2014, 03:22
– THE GRE QUANTITATIVE SECTION – The area of a sector is found in a similar way to finding the pptx
... problem as needed by choosing b or d next, depending on whether you ANSWER SHEET 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 a a a a a a a a a a a a a a a a a a a a a a a a a a a b b ... 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 a a a a a a a a a a a a a a a a a a a a a a a a a a a b b b b b b b b b b b b b b b b b b b b b b b b b b b 212 c c c c c ... 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 a a a a a a a a a a a a a a a a a a a a a a a a a a b b b b b b b b b b b b b b b b b b b b b b b b b b c c c c c c c c c...
Ngày tải lên: 18/06/2014, 17:20
10 start up secrets you don’t have to learn the hard way from guy kawasaki
Ngày tải lên: 06/12/2015, 23:03
A new way to learn mathematics
... speed best • Have a Back Up Plan and a Back up to the Back Up Plan • In case personal computer goes bad • RCC – Library – Labs – Public Library Excuses • Saying that the computer went bad is NO EXCUSE! ... • Have all Resources Available Have Calculator, Textbook Have Notebook that is updated Have pencil and paper – Do all those problems that need to be worked out completely with pencil and paper ... Watch Deadlines and keep ahead of time schedule • Use All Resources Available • Keep a Positive Attitude! Success is Not Magic! Attendance • Attendance is Crucial for Success! • Be On Time – Tardy...
Ngày tải lên: 30/11/2016, 22:51
Studying the english language in an english speaking country is the best but not the only way to learn language
Ngày tải lên: 07/02/2018, 17:49
A smarter way to learn javascript
... talking about a type of variable called an array Whereas an ordinary variable has a single value assigned to it—for example, or "Paris"—an array is a variable that can have multiple values assigned ... that refers to a particular value, "Mark." In the same way, a variable is a word that refers to a particular value A variable is created when you write var (for variable) followed by the name ... of JavaScript's keywords—the special words that act as programming instructions, like alert and var Here are the rest of the rules: A variable name can't contain any spaces A variable name can...
Ngày tải lên: 13/05/2018, 09:51
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf
... MacDonald can be said to have a larger degree of dispersion of data around the mean than Max hamburger in those attributes Max hamburger had a larger standard deviation than MacDonald in these attributes“its ... slogan is a visible feature of a brand There can be a strong link between a slogan and a brand The slogan and jingle are powerful and can be a great change for a brand • Be different and memorable: ... good and customer service was good” In total, MacDonald achieved a higher overall mean value than Max hamburger In terms of standard deviation, we found out that MacDonald had a larger standard...
Ngày tải lên: 24/09/2012, 17:19
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... CP-pyk (5Â-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3Â) (N ẳ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products ... Denmark) DNA techniques All manipulations were performed as described by Sambrook et al [24] Taq DNA polymerase (New England Biolabs, Frankfurt am Main, Germany) was applied for analytical purposes...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx
... kinases such as Akt has been shown to increase HSF1 activity Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal-regulated kinase (ERK), a ... the mammalian stress response: characterization of changes in cytoplasmic organelles, cytoskeleton, and nucleoli, and appearance of intranuclear actin filaments in rat fibroblasts after heat-shock ... turn activate the Ras ⁄ Rac1 pathway, which has been shown to play a critical role in HSF1 activation and HSP up-regulation [14] We have reported that specific alterations in the membrane physical...
Ngày tải lên: 07/03/2014, 12:20
Money and happiness a guide to living the good life
... nongraduates I have an associate degree People with an associate degree earned an average of $33,000 in 2000 I have a bachelor’s degree About one in four Americans ages 25 and older has attained a bachelor’s ... she says with a laugh When she was 14, her parents started a restaurant, and she began waitressing at night Her father encouraged her to save up for substantial needs, like a car, rather than frittering ... years “My mother had the last laugh,” Deb says “She has had a fabulous retirement, she and her boyfriend ride around [Florida’s] intercoastal waterway on their yacht My father had health setbacks...
Ngày tải lên: 12/03/2014, 14:51
A Strategy to Engage the Private Sector in Climate Change Adaptation in Bangladesh docx
... and in particular the climate change action plan programmes The latter offer a clear road map as to how Bangladesh can evolve a strategy of both adaptation and mitigation of climate change Warmer ... Climate Change: Principles and Lessons for Equitable Adaptation Funding Available at: http://www.actionaidusa.org/images/climate_change/Comp ensatingforClimateChange.pdf Agrawala S and Fank hauser ... Local Coping Strategies Database It provides a summary of adaptation practices by a large range of organizations, agencies and businesses Around 100 cases are categorized under: (a) type of hazard,...
Ngày tải lên: 16/03/2014, 14:21
Greener Events A guide to reducing the environmental impacts of conferences and seminars potx
... display materials [ ] Seek naturally lighted meeting & exhibition areas [ ] Format any handouts so as to minimise the amount of paper used [ ] Where possible, write material in a re-usable format ... Choice (and audio visual) Suitability of the venue can mean more than just its layout and facilities Other facilities or amenities in the area and appropriateness for the theme of the event can be ... that this guide is used to help select a suitable venue and to aid planning discussions with management and staff at the venue A copy should be passed to the venue manager by the event manager...
Ngày tải lên: 16/03/2014, 19:20
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
... Table 7. Standardized score for costs of combinations Measure A1 +A2 .3 A1 +B1 A1 +B2 A1 +B1+B2 A2 .1 +A2 .3 A2 .1+B1 A2 .2 +A2 .3 A2 .2+B1 A2 .3+B1 A2 .3+B1+B2 Standardized cost Standardized score ... doing so, the consensus on the problems and their solutions can be reached. However, it is noted that MCA is subjective in its nature. In case the quantitative data are available, quantitative analysis (i.e. numerical ... own advantages and disadvantages. Table 1 summarizes some these methods and their features. In comparison with the ranking and rating methods, pairwise comparison and trade‐off ...
Ngày tải lên: 22/03/2014, 12:20
drama a way to social inclusion
... the garments are produced These areas include Asia, Africa, Eastern Europe, and Central America The CCC also co-operates with similar campaigns in the United States, Canada, and Australia What ... Drama Way project in the future! Behalf of the DramaWay project team Jouni Piekkari Editor, drama trainer |7| |8| Introduction What is Drama Way? There is a need for alternative and more adaptable ... Legioonateatterin opetukset – Kokemuksia ja ajatuksia ohjaajan ja kouluttajan roolista Kuikka, Suvi (toim.): Friikki Nuorisoteatteritoiminnan opas Vapaan Sivitystyön liitto Owens, Allan and Barber,...
Ngày tải lên: 23/05/2014, 19:18
hacking vim a cookbook to get the most out of the latest vim editor
... Bhushan Pangaonkar Proofreader Chris Smith Nikhil Bangera Layouts and Illustrations Technical Editor Shantanu Zagade Ajay S Cover Designer Editorial Manager Dipali Chittar Shantanu Zagade About ... was first released by Bram Moolenaar in November 1991 as a clone of the Unix editor vi for the Amiga platform The first release of Vim for the Unix platform was out a year later and right away, ... Vim under a so-called charityware license What this means is that you can copy Vim as much as you like, but in exchange you are encourage to make donations to a charity You can read more about the...
Ngày tải lên: 01/06/2014, 10:43