a useful material for sensors and ultrasound applications

Báo cáo khoa học: "A Bag of Useful Techniques for Efficient and Robust Parsing" ppt

Báo cáo khoa học: "A Bag of Useful Techniques for Efficient and Robust Parsing" ppt

... between 20 and 120 unary and binary rule schemata Since all rule schemata in our system bear a unique number, this filter can be realized as a three dimensional boolean array Thus, access costs are ... the application of lexical rules (see also section for a similar approach) For each stem, all results are stored in compact form as one compiled LISP file, which allows to access and load a requested ... this disadvantage, our approach focuses on partial analyses which are combined in a later stage to form total analyses without giving up the correctness of the overall deep grammar But what can be...

Ngày tải lên: 08/03/2014, 06:20

8 340 0
ammonia sensors and their applications — a review

ammonia sensors and their applications — a review

... Normally seas and oceans act as a sink for ammonia but occasionally they act as an ammonia source [22,23] Ammonia is produced because of the existence of ammonium ions that are transformed to gaseous ... gaseous ammonia by alkaline rainwater [23] Application areas of ammonia sensors There are many ways to detect ammonia High concentrations are easy to detect because the gas has a very penetrating ... Ammonia-sensing characteristics of Pt and SiO2 doped SnO2 materials, Solid-State Electron 45 (2001) 347–350 [66] M Aslam, V .A Chaudhary, I.S Mulla, S.R Sainkar, A. B Mandale, A. A Belhekar, K Vijayamohanan,...

Ngày tải lên: 19/03/2014, 16:47

12 649 0
Báo cáo hóa học: " Research Article Schur-Convexity for a Class of Symmetric Functions and Its Applications" pptx

Báo cáo hóa học: " Research Article Schur-Convexity for a Class of Symmetric Functions and Its Applications" pptx

... Engineering, Academic Press, New York, NY, USA, 1979 19 S.-H Wu, “Generalization and sharpness of the power means inequality and their applications, ” Journal of Mathematical Analysis and Applications, ... S Aujla and F C Silva, “Weak majorization inequalities and convex functions,” Linear Algebra and Its Applications, vol 369, pp 217–233, 2003 K Guan, “The Hamy symmetric function and its generalization,” ... Analysis and Applications, vol 335, no 2, pp 1294–1308, 2007 18 A W Marshall and I Olkin, Inequalities: Theory of Majorization and Its Applications, vol 143 of Mathematics in Science and Engineering,...

Ngày tải lên: 22/06/2014, 02:20

15 301 0
Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx

Báo cáo khoa hoc:" Quantitative competitive reverse transcription polymerase chain reaction is not a useful method for quantification of CD4 and CD8 cell status during HIV infection" pptx

... to avoid amplification of cellular DNA contaminating RNA preparations Products are generated from cDNA and deletional mutants are constructed by restriction endonuclease digestion and religation ... by Dr Martha Pavlakis, Harvard Medical School, Boston, MA The primer sequences are: Sense 5'GGTGAAGGTCGGAGTCAACG3', Antisense 5'CAAGTTGTCATGGATGACC3' Discussion Our results indicate that there ... (data not shown) In each assay we performed at least six different reactions for each sample using increasing amounts of competitor DNA The amounts of sample were quantitated by extrapolating across...

Ngày tải lên: 11/08/2014, 08:20

4 319 0
Hydrokinetic Energy Conversion Systems And Assessment Of Horizontal And Vertical Axis Turbines For River And Tidal Applications A Technology Status Review

Hydrokinetic Energy Conversion Systems And Assessment Of Horizontal And Vertical Axis Turbines For River And Tidal Applications A Technology Status Review

... Fig Use of ducts and applications The present trend clearly indicates that the area of multiple application (such as, river, tidal, artificial waterways, dam tailrace, and industrial outflows) is ... facility, where the tailrace of a stream can be utilized for capacity augmentation (i.e, resource usage maximization) [10,19]) Direct water pumping for irrigation, desalination of seawater, and ... extract energy from tidal and marine currents as opposed to tidal barrages where stored potential energy of a basin is harnessed While modularity and scalability are attractive features, it is also...

Ngày tải lên: 24/11/2016, 10:42

13 743 0
Compiling a reading material for students of articulation program at haiphong private university

Compiling a reading material for students of articulation program at haiphong private university

... double passage section, you will likely find any combination of the above You can have: A letter and an email An invoice and an email An email and an email A schedule and a memo An article and a letter ... for a job application and for graduation needs Question to and question to for students and teachers respectively refer to grammar and vocabulary learning and teaching Page | 19 Question 2: Teachers ... they obtain information that is relatively easy to tabulate and analyze” (Richards, 2001:60) They can be seen as a useful tool for “providing the participants‟ personal details, educational background,...

Ngày tải lên: 14/12/2013, 16:45

33 441 1
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared ... guidelines and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢; Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA ... enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and stop primers Abstart and Abstop at 600 nm each, and 200 lm each of dATP, dCTP, dGTP and dTTP The product was separated from...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... SV40T Ag and the 3¢ portion of the tsA58T Ag cDNA carrying the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, ... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products were ... Dong QG, Bernasconi S, Lostaglio S, De Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from...

Ngày tải lên: 18/02/2014, 17:20

11 874 0
Tài liệu A Marketing Guide for Small and Medium Sized Primary Forest Products Processors pdf

Tài liệu A Marketing Guide for Small and Medium Sized Primary Forest Products Processors pdf

... Specialty Product A B C D Mass Market Niche Market F Bibliography Essel, A E 1993 Niche marketing—An alternative for small and part-time farmers Farm Management Update Blacksburg, VA: Virginia Tech ... Graduate Research Assistant Department of Wood Science and Forest Products Virginia Polytechnic Institute and State University Blacksburg, VA Published by: Northeastern Area State and Private Forestry ... instead They were transformed into marketing managers, marketing engineers and marketing associates, and some even became marketing representatives.” —Lamont C Blake Marketing Consultant As can...

Ngày tải lên: 18/02/2014, 22:20

92 2,2K 0
Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx

Tài liệu Báo cáo khoa học: "A Statistical Model for Unsupervised and Semi-supervised Transliteration Mining" pptx

... Markov Models (Nabende, 2010; Darwish, 2010; Jiampojamarn et al., 2010), Finite State Automata (Noeman and Madkour, 2010) and Bayesian learning (Kahki et al., 2011) to learn transliteration pairs ... algorithm to estimate the counts of multigrams The algorithm has a forward variable α and a backward variable β which are calculated in the standard way (Deligne and Bimbot, 1995) Consider a node r which ... and North American Association for Computational Linguistics Conference, Edmonton, Canada A Kumaran, Mitesh M Khapra, and Haizhou Li 201 0a Report of NEWS 2010 transliteration mining shared task...

Ngày tải lên: 19/02/2014, 19:20

9 521 0
Tài liệu Báo cáo khoa học: "A Writing Assistant for CAT and CALL" pdf

Tài liệu Báo cáo khoa học: "A Writing Assistant for CAT and CALL" pdf

... Proceedings of ACL Y Ma, N Stroppa, and A Way 2007 Bootstrapping word alignment via word packing In Proceedings of ACL L Nepveu, G Lapalme, P Langlais, and G Foster 2004 Adaptive language and translation ... train TransAhead, we used British National Corpus and Hong Kong Parallel Text and deployed GENIA tagger for POS analyses To evaluate TransAhead in CAT and CALL, we introduced it to a class of 34 ... interactivity made translation and language learning more fun and the participants found TransAhead very recommendable and would like to use the system again in future translation tasks Acknowledgement...

Ngày tải lên: 22/02/2014, 03:20

4 393 0
Tài liệu A Science Roadmap for Food and Agriculture pdf

Tài liệu A Science Roadmap for Food and Agriculture pdf

... interfaces between animal agriculture and landscapes (natural, managed, and urban) New initiatives to characterize the genetic architecture and resources of various agriculture animals and aquaculture ... more accurate estimates of climate change impacts, the potential costs and benefits of adaptation, and to validate and calibrate models • Quantify costs and benefits of adaptation at the farm ... collaborations and data exchange systems that establish food security and safety • National policies for systems-based sustainable production of abundant and safe food • Standardized management systems and...

Ngày tải lên: 22/02/2014, 05:20

104 415 0
Tài liệu NON-WOOD PLANTS AS RAW MATERIAL FOR PULP AND PAPER pptx

Tài liệu NON-WOOD PLANTS AS RAW MATERIAL FOR PULP AND PAPER pptx

... FINLAND Saijonkari-Pahkala, K Non-wood plants as raw material for pulp and paper Non-wood plants as raw material for pulp and paper Katri Saijonkari-Pahkala MTT Agrifood Research Finland, Plant ... my parents Mirjam and Arvo Saijonkari Jokioinen, October 2001 Katri Saijonkari-Pahkala AGRICULTURAL AND FOOD SCIENCE IN FINLAND Saijonkari-Pahkala, K Non-wood plants as raw material for pulp and ... AGRICULTURAL AND FOOD SCIENCE IN FINLAND Saijonkari-Pahkala, K Non-wood plants as raw material for pulp and paper Low mineral content is a desired quality for raw material for pulp and paper production...

Ngày tải lên: 22/02/2014, 09:20

101 643 0
Tài liệu Báo cáo khoa học: "A COMMON FRAMEWORK FOR ANALYSIS AND GENERATION" potx

Tài liệu Báo cáo khoa học: "A COMMON FRAMEWORK FOR ANALYSIS AND GENERATION" potx

... the translations we have allocated to the lexical items in our vocabulary will be generated Tibia is true of all NL s!/stems that translate from a natural language into some formal representation ... system are acceptable as they are proposed, is more flexible than any approach which depends on getting a reaiisable expression of the representation language from the application program and systematically ... approach to generating text from a given logical form is described The algorithm described by Shieber and his colleagues takes a realisable A- calculus expression and uses their syntactic/semantic...

Ngày tải lên: 22/02/2014, 10:20

4 502 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C ppt

... is variability in coverage among states Additionally, there are racial and ethnic disparities in childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children ... John Ward, Dale Hu, Cindy Weinbaum, and David Bell, Centers for Disease Control and Prevention; Chris Taylor and Martha Saly, National Viral Hepatitis Roundtable; Lorren Sandt, Caring Ambassadors ... hepatitis B and hepatitis C and guidance on reducing them Information about health disparities related to hepatitis B and hepatitis C To increase knowledge and awareness about hepatitis B and...

Ngày tải lên: 06/03/2014, 01:20

191 458 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C doc

... and C http://www.nap.edu/catalog/12793.html Acronyms and Abbreviations AASLD ACIP ACOG AHRQ AIDS ALT anti-HBc anti-HBs anti-HCV API AST AVHPC American Association for the Study of Liver Diseases ... childhood vaccination rates—Asian and Pacific Islander (API), Hispanic, and African American children have lower vaccination rates than non-Hispanic white children Regarding vaccination of children and ... state and local governments, professional organizations, health-care organizations, and educational institutions) to develop hepatitis B and hepatitis C educational programs for health-care and...

Ngày tải lên: 06/03/2014, 01:20

253 370 0
Hate on the Internet: A Response Guide for Educators and Families pptx

Hate on the Internet: A Response Guide for Educators and Families pptx

... Partners Against Hate Hate on the Internet: A Response Guide for Educators and Families represents a collaborative effort of the Anti-Defamation League (ADL), National Chair, Barbara Balser and ... Web sites that include hate propaganda from the National Alliance and David Duke “If you are a teacher or student, I hope you will take a stand for right and wrong and use this information to enlighten ... site addresses were accurate and provided material that was, in the judgment of Partners Against Hate staff, appropriate for all audiences Partners Against Hate is not responsible for future changes...

Ngày tải lên: 06/03/2014, 21:20

63 1,4K 0
Báo cáo khoa học: Purine nucleoside phosphorylases from hyperthermophilic Archaea require a CXC motif for stability and folding pot

Báo cáo khoa học: Purine nucleoside phosphorylases from hyperthermophilic Archaea require a CXC motif for stability and folding pot

... folding catalysts (reactivation assay) The catalytic activity of (A) SsMTAPII and SsMTAPIIC259S ⁄ C261S and (B) PfPNP and PfPNPC254S ⁄ C256S was then measured under standard assay conditions The activity ... was analyzed by catalytic activity measurements performed under standard conditions Reactivation assay of SsMTAPII, PfPNP and their CXC-lacking mutants The activity of SsCSC and PfCGC as catalysts ... concentration of mm was then added and A2 96, as a result of RNase-catalyzed cCMP hydrolysis, was monitored continuously for 210 at 30 °C The positive control was the reactivation of sRNaseA catalyzed...

Ngày tải lên: 07/03/2014, 00:20

7 496 0
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf

... ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC Table Yeast ... membrane was from Millipore (Bedford, MA, USA) Goat polyclonal anti-(yeast Vps4p) IgG was from Santa Cruz Biotechnology (Santa Cruz, CA, USA) and rabbit polyclonal anti-(carboxypeptidase Y) and anti-calmodulin ... Francisco, CA, USA) Horseradish peroxidaseconjugated goat anti-(mouse IgG) and gel-filtration standards were from Bio-Rad Laboratories (Hercules, CA, USA) Penta His mAb and Ni-NTA agarose were from Qiagen...

Ngày tải lên: 07/03/2014, 05:20

23 491 0
Acute and Chronic Sinusitis - A Practical Guide for Diagnosis and Treatment docx

Acute and Chronic Sinusitis - A Practical Guide for Diagnosis and Treatment docx

... sinus ostia to allow adequate drainage and aeration • Senior BA, Kennedy DW Management of sinusitis in the asthmatic patient AAAI J,1996;77:6-19 0031003 Development of Sinuses • Maxillary and ethmoid ... Physicians supported by an educational grant from Aventis Pharmaceuticals The AAFP gratefully acknowledges Harold H Hedges, III, M.D and Susan M Pollart, M.D for developing the content for the AAFP ... • Nasal polyps • Congenital atresia • Lymphoid hyperplasia • Nasal structural changes found in Downs syndrome 0031003 27 Vasculitides, Autoimmune and Granulomatous Diseases • Churg-Strauss vasculitis...

Ngày tải lên: 16/03/2014, 14:20

81 535 0
w