a unifying framework for compressed pattern matching

... However, standard approaches typically ignore the particular analytical structure of the problem at hand Thus,... if r ≥ r The framework A1 , A2 , A3 is related to the concept of standard interference ... introduced by Yates [1], where scalability was required instead of scale invariance Scalability was motivated by a specic power control probA1 A2 lem It will be shown in Section 2.4 that standard ... case, and most results derived in this book immediately transfer to standard interference. .. 1.2 Basic Axiomatic Framework of Interference Functions Axiomatic characterizations have a long-standing

Ngày tải lên: 29/05/2014, 16:52

... that specify lateral instantaneous accelerations. The lateral accelerations can take values in an interval [ ? ?a max , a max ], where a max repre- sents a maximum limit on the possible lateral acceleration. ... the optimal solution is a feedback-control rule, usually called a policy. More formally, a policy is a mapping that, at each time, takes the belief state and gives us a particular control action, ... belief state is a quantity that is already available (approximately) as track states. Once we have specified the above components of a POMDP, the guidance problem is posed as an optimization problem

Ngày tải lên: 21/06/2014, 22:20

... [23] A Papoulis and S U Pillai, Probability, Random Variables, and Stochastic Processes, McGraw-Hill, Boston, Mass, USA, 4th edition, 2002 [24] H A David and H N Nagaraja, Order Statistics, ... Complemented with channel quantizations as CDI, user scheduling at the base station of a MIMO broadcast channel is performed. The design frame- workforscalarfeedbackherepresentedcanbeappliedtoany system ... with channel quality information (CQI) used to perform user scheduling. In this paper, we present a design framework for scalar feedback in MIMO broadcast channels with limited feedback. An approximation

Ngày tải lên: 22/06/2014, 06:20

... [23] A Papoulis and S U Pillai, Probability, Random Variables, and Stochastic Processes, McGraw-Hill, Boston, Mass, USA, 4th edition, 2002 [24] H A David and H N Nagaraja, Order Statistics, ... Complemented with channel quantizations as CDI, user scheduling at the base station of a MIMO broadcast channel is performed. The design frame- workforscalarfeedbackherepresentedcanbeappliedtoany system ... with channel quality information (CQI) used to perform user scheduling. In this paper, we present a design framework for scalar feedback in MIMO broadcast channels with limited feedback. An approximation

Ngày tải lên: 22/06/2014, 19:20

... A UNIFYING APPROACH FOR CERTAIN CLASS OF MAXIMAL FUNCTIONS AHMAD AL-SALMAN Received 16 January 2006; Revised 12 April 2006; Accepted 13 April 2006 We establish L p estimates for certain class ... may assume that P does not contain |x| d+1 as one of its terms. By dilation invari- ance, we may also assume that  |α|=d+1   a α   = 1. (3.6) 8 A unifying approach for certain class of maximal ... Publishing Corporation Journal of Inequalities and Applications Volume 2006, Article ID 56272, Pages 1–17 DOI 10.1155/JIA/2006/56272 2 A unifying approach for certain class of maximal functions On

Ngày tải lên: 22/06/2014, 22:20

... “turbo-estimation” approach can be regarded as a special case of the expectation-maximization (EM) algorithm. This leads to a gener al theoretical framework for turbo synchronization that allows to ... and parameter estimation within a turbo (iterative) receiver As a case study, we demonstrated the application of the proposed mathematical formulation to the particular case of joint carrier ... derive parameter estimation procedures for carrier phase and frequency offset, as well as for timing offset and signal amplitude. The proposed mathematical framework is illustrated by simulation

Ngày tải lên: 23/06/2014, 00:20

... of a PE read, gene annotation sets, expression values, and so on Software and data availability FusionSeq is available for download at [34] Data sets used in this study are available via ... of animal genes with the aim of providing a curated list of orthologs and paralogs... of each primer (forward, TMPRSS2 exon 1 - TAGGCGC GAGCTAAGCAGGAG; reverse, ERG exon 5 GTAGGCACACTCAAACAACGACTGG; ... Fujiwara S, Watanabe H, Kurashina K, Hatanaka H, Bando M, Ohno... considerations of computational complexity and statistical significance are mandatory FusionSeq: a modular framework In

Ngày tải lên: 09/08/2014, 22:23

... L4 and adult. ROC curves are plotted based on the results of 100 trials of cross-validation. For each trial, the dataset was randomly separated into two halves: one half as training data and ... Schematic diagram of our data binning and supervised analysis. (a) DNA regions around the transcription sta rt site ( TSS) and transcription terminal site (TTS) of each transcript were separated ... sta ge, we repeated the analy- sis in other stages, including late embryo, larval stages and young adult. Although the exact values of correla- tion coefficients vary across stages, the spatial

Ngày tải lên: 09/08/2014, 22:23

... instruments are available for measuring an organization's 'learning' capability [55]. Readiness for implementation: Tangible and immediate indicators of organizational commitment ... Organizational Transformation Model VanDeusen Lukas CV, Holmes SK, Cohen AB, Restuccia J, Cramer IE, Shwartz M, Charns MP: Transformational change in health care systems: An organizational model. ... Here? A Decisionmaker's Guide to Adopting Innovations. Agency for Healthcare Research and Quality (AHRQ); 2008. 17 Availability, Responsiveness and Continuity: An Organizational and Community

Ngày tải lên: 11/08/2014, 05:21

... perl-Apache-ParseFormData A Perl library for accessing form data in mod_perl perl-Class-Base A Perl base class for other modules perl-Class-DBI A Perl tool for abstracting database access perl-Class-DBI-ConceptSearch ... the automatic generation of several web application layers that are manually created in most other frameworks Turnkey uses a database schema, or definition, to automatically create most of an ... Genome Database [http://www.yeastge nome.org] Jaiswal P, Ni J, Yap I, Ware D, Spooner W, Youens-Clark K, Ren L, Liang C, Zhao W, Ratnapu K, Faga B, Canaran P, Fogleman M, Hebbard C, Avraham S,

Ngày tải lên: 14/08/2014, 20:22

... updated information is organized differently (for example, in a data warehouse or data mart) than, say, for operational or transactional applications BI initiatives focus on locating and ... “forecasting” becomes packaged as an analytic application of “sales forecasting” and put in the hands of a sales manager 12 represent emerging markets Analytic applications can be bought as ... "Producers" ( Analysts) Business Process Applications (Performance Management and Transaction Processing) BI Capabilities (Platform/Tools and Embedded in Analytic Application) Analytic Applications

Ngày tải lên: 29/08/2014, 22:24

... distributed manner This framework is robust to changes and adaptable to a dynamically changing... allocation” can refer to a supervisor or some authority having the final say on all agents’ allocated ... a central database 2.2.3 Machine Learning Machine... term task can encapsulate the idea of a ”role”, as ultimately, it boils down to the agent performing tasks A ”role” can be seen as ... the centralised multi- agent negotiation approach for collaborative air traffic... Thesis of these challenges, namely that of task allocation Task allocation is a fundamental issue

Ngày tải lên: 09/09/2015, 10:15

... International Workshop on Agent Theories, Architectures and Languages, Boston, MA, USA. Madhavan, R. and H. F. Durrant-Whyte (2004). Natural landmark-based autonomous vehicle navigation. Robotics and ... that may prove capable of... on-board, using lightweight computational devices (Garcia and Valavanis, 2006; Valavanis et al., 2005) The miniaturization of such devices paves the way for autonomous ... and Engineering, for all the administrative assistance and advice throughout my whole candidature. Finally, I wish to thank the Agency for Science, Technology and Research (A* STAR) for scholarship

Ngày tải lên: 11/09/2015, 16:08

... and has always been a struggle for me. It is during these moments one realizes that all a person really needs is a listening ear, an extra pair of hands and some words of motivation to fuel an ... boys who have taken permanent residency in the lab, Mana Saedan for his advice and cool demeanour; Yuanping, Tirtha and Gim Hee for the times when I was stuck in thought. To Mum and Dad for their ... [11], RAPT (Robot Automatically Programmed Tool) [12, 13, 14] and SLIM (Standard Language for Industrial Manipulators) [15] are examples of such a language On the fourth level, instead of

Ngày tải lên: 11/09/2015, 21:49

... hierarchical scheduling framework is to a large... and its various extensions have been accepted as a workload model that accurately characterizes many traditional hard real- time applications, ... such fine time granularity, that it is available at fractional rates to the task groups This means the resource would be available to all task groups at a fractional rate at all times, which ... be partitioned if it is available to a scheduling component at some times at its full capacity and unavailable at all other times A partitioned resource is a shared resource on the basis

Ngày tải lên: 16/09/2015, 12:42

... 2 attributed as a catalyst poison [2, 3], an active intermediate in the direct pathway [4-10], and even a catalyst [11]. There are also many papers which do not consider adsorbed formate at all. ... to a linearly varying potential, is a standard electroanalytical technique for assessing the reactivity of an electrochemical half-cell reaction. A significant current flow at low overpotentials ... unifying understanding was derived after painstakingly analyzing a large amount of published data for underlying patterns and trends. Several new perspectives and reactions are proposed for the first

Ngày tải lên: 28/09/2015, 13:38

... the Same Capacity Productivity Approach for Resource Allocation with the Same Capacity Comparison of Two Approaches in the Same Capacity System Parameters and Strategic Approaches New Allocation ... Scale Efficiency Approach for Resource Allocation Productivity Approach for Resource Allocation Approaches for Developing Channel Strategy Approaches for Planning Allocation Policy Non-dominated ... outputs based on reactions to market prices DEA (Data Envelopment Analysis) is a mathematical programming based on nonparametric technique that is designed to compare and evaluate the relative...

Ngày tải lên: 22/05/2016, 11:25

... asiakasnäkemyksen prosessimainen eteneminen sekä taipumus rakentaa havainnoista suurempia, suhteellisia kokonaisuuksia Analysoinnin satunnaistekijöiden ehdotetaan olevan alisteisia tiedostamattomille ... rakennetaan työn teoriapohja tarkastelemalla eri näkemyksiä asiakkaan arvon muodostumiseen Casetutkimuksessa esitellään asiakaslähtöisen strategian jalkauttamisprosessi ja sen hahmottamiseen sekä kommunikointiin ... marketing can be operationalized as a set of complementary capabilities that lead to cultural and behavioural characteristics of an organization (Jaworski et al., 2000; Slater and Narver, 1995)

Ngày tải lên: 19/12/2016, 12:12

... available It also makes it easy to integrate citation-based impact analysis data and annotations into other applications It exposes information about authors, disciplines, and relationships among authors ... (scholarometer.indiana.edu/data.html) The aim is to make information about authors and disciplines based on citation analysis available on the Semantic Web Linked Data is a style of publishing and ... bibliographic data and user-supplied annotations (Materials and Methods section) As an illustration of potential applications of crowdsourced scholarly data, we report on data sharing and interactive

Ngày tải lên: 12/12/2017, 06:36

... important information There are two types of measurables The first are “absolute” measurables, such as defects, and setup time that can be compared to an absolute standard Thus, we may say a setup ... machine, part, or human Thus, in order to truly understand a company and understand what is not lean, we must take a macroscopic look at the plant, and eliminate all unnecessary storage, transportation ... which translate into real dollars in costs to the company in addition to the pain and aggravation which will have adverse affects on operators’ motivation, and quality of work In addition, carpal

Ngày tải lên: 25/02/2019, 19:47