a uniform treatment of pragmatic inferences in simple

... can never be cancelled. We are not aware of any forma- lism or computational approach that offers a unified explanation for the cancellability of pragmatic infe- rences in general, and of ... contains more information and that information can be more easily updated in the fu- ture. That means that if an interpretation m0 makes an utterance true by assigning to a relation R a defensible ... conditions that pertain to pragmatic inferences are captured using V trt. Let uttered(u) be the logical translation of a given utterance or set of utterances. We say that ut- terance u pragmatically...

Ngày tải lên: 08/03/2014, 07:20

Ngày tải lên: 22/03/2014, 18:20

Ngày tải lên: 20/06/2014, 00:20

... fucose/galactose solution to block P. aeruginosa lectins PA-I and PA-II as an alter- native approach to reduce airway colonisation with this bacteria. P. aeruginosa lectins PA-I and PA-II that bind ... surprising. It seems that inhalation alone can clear bacteria from the airways without a strong inflammatory response due to physical elimination of P. aeruginosa via the muco- ciliary elevator. ... glycocalix of the mammalian cells. By adding simple sugars, this attachment can be blocked as shown in external otitis caused by P. aeruginosa (5). However, simple adhesion via lectin sugar interactions...

Ngày tải lên: 03/11/2012, 11:48

Ngày tải lên: 26/11/2013, 13:26

Ngày tải lên: 26/11/2013, 13:30

Ngày tải lên: 14/12/2013, 00:40

... to be insufficient, and early intervention was avoided in the name of regulatory forbearance. Repealing Glass-Steagall The Glass-Steagall Act of 1933 had established a firm separation ... accounting, financial instruments are revalued and set to currently available market prices, even in the absence of a transaction. The SEC maintained its position on mark-to-market in 2008 and ... hedge against risk, protecting against a decline in value of the underlying asset. Alternatively, they can be used for simple speculation, to profit off an expected change in value. Derivatives...

Ngày tải lên: 16/02/2014, 11:20

... construction of naval ships is one of the more complicated tasks of weapon system engineering and manufacturing that a country can undertake. Naval shipbuilding requires both heavy manufacturing and ... Cost Nuclear aircraft carrier 51 Amphibious ship 47 Attack submarine 39 Surface combatant 32 1 Ideally, we would analyze data on how the labor, material, and equipment percentages have changed over ... can calcu- late an overall escalation rate for fighter aircraft, indicated by the solid line representing the best exponential fit to the data. is indicates a 9.3 percent annual growth rate in...

Ngày tải lên: 17/02/2014, 22:20

... aircraft NASA National Aeronautics and Space Administration NATO North Atlantic Treaty Organization NAVAIR Naval Air Systems Command NGC Northrop Grumman Corporation OPNAV Office of the Chief of ... understand the causes of cost escalation, we needed a database with detailed technical characteristics for each aircraft model. HAPCA con- tains data on performance and weight—including cruising and ... because the P-1 data include a broader set of systems, such as the T-34 and the Joint Primary Aircraft Training System, most with lower rates of cost increase, that are not in the HAPCA data. xv Summary As...

Ngày tải lên: 17/02/2014, 23:20

... Systems. International Journal of Artificial Intelligence in Education, 16. C. Rich and C. L. Sidner. 1998. COLLAGEN: A Col- laboration Manager for Software Interface Agents. User Modeling and ... Higgins, J. Burstein, D. Marcu and C. Gentile. 2004. Evaluating Multiple Aspects of Coherence in Student Essays. In Proc. of HLT-NAACL. J. Hirschberg and C. Nakatani. 1996. A prosodic analy- sis ... Load and Mul- timodal Communication Patterns. In Proc. of Interna- tional Conference on Multimodal Interfaces. R. Passonneau and D. Litman. 1993. Intention-based segmentation: Human reliability...

Ngày tải lên: 20/02/2014, 12:20

... that their sys- tem represents a powerful way of dealing with su- perlatives computationally, a closer inspection of their approach, and in particular of the gold stan- dard data set, reveals ... computational treatment of su- perlatives, starting with superlative con- structions and the main challenges in automatically recognising and extracting their components. Initial experimental ... Elements of a Computational Treat- ment of Superlatives For an interpretation of comparisons, two things are generally of interest: What is being compared, and with respect to what this comparison...

Ngày tải lên: 20/02/2014, 12:20

... medium exchange and then gradually increased up to 10 h, when maximal incorporation was attained. This was followed by a decrease. Under hypoxia, in contrast, incorporation decreased to a background ... and reoxygenation. The alkaline sedimentation profiles of HeLa and CCRF cells after hypoxia and reoxygenation already revealed [4] that hypoxic incubation caused significant accumulation of initiation ... with NaCl/P i . During the last wash total DNA was stained with bisbenzimide (2 lgÆmL )1 in NaCl/ P i ). Finally PCNA (Alexa FluorÒ 568 stain) and total DNA (bisbenzimide stain) were visualized...

Ngày tải lên: 21/02/2014, 00:20

... Tutiya, A. Ichikawa, and Y. Den. 1998. An analysis of turn-taking and backchannels. lan- guage and Speech, 23:296-321. S. Lamia, G. Bugmann, T. Kyriacou, J. Bos, and E. Klein. 2001. Training ... model was applied to the test set. 4.3 n-gram Part -of- Speech Model Separating the data into training, validation and test sets was carried out by generating a random dialogue ID. The IDs are in the ... placement of backchannel continuers, using only limited processing and information that is readily available to current spoken dialogue systems. Pause duration and a statistical part -of- speech language model...

Ngày tải lên: 22/02/2014, 02:20

... analgesia pumps. The OAAI ignores clinical activities other than epidural analgesia and cesarean anesthesia (including anesthesia for retained placenta and complicated vaginal deliveries, antenatal ... determinants of obstetric anesthesia workload and that a typical epidural takes about half the time of a typical cesarean. Accordingly, the OAAI for each hospital was calculated as ((0.75 * number of ... obstetric anesthesia activity index (OAAI) The majority of anesthesia workload in the labor ward comprises epidural labor analgesia and cesarean delivery. The OAAI is a formula composite comprising...

Ngày tải lên: 05/03/2014, 15:20

... are being taken up in 46 towns in the states of A. P., Bihar, Gujarat, Karnataka, Maharashtra, M.P., Orissa, Punjab, Rajasthan and Tamil Nadu. About 1928 mld of sewage is targetted to be intercepted, ... surrounding of an industrial area for an improvement in ambient water quality. CVM was also applied in an attempt at valuing the benefits from the Ganga Action Plan (Markyanda & Murty, 2000). A method ... Panda P.K. (1996) "The effects of safe drinking water and sanitation on diarrhoeal diseases among children in rural Orissa" in K. Pushpangadan ed., Proceedings of the National Seminar...

Ngày tải lên: 06/03/2014, 15:21

... classify and evaluate pain before deciding on pharmacological and non-pharmacological therapy Determine potential barriers to pain management DEVELOP/ADJUST INDIVIDUALPAINMANAGEMENTPLAN Pharmacological ... play a crucial role in making rapid, effective and safe pain management available at various levels of the health system. Policy-makers and regulatory authorities are crucial in facilitating ... retrieval and appraisal. Principle Optimal pain management may require a comprehensive approach comprising a combination of non-opioid,opioidanalgesics,adjuvantsandnon-pharmacologicalstrategies. A comprehensive approach...

Ngày tải lên: 07/03/2014, 04:20

... in most of the Archaea, except in the Thermoplasmata class of the Euryarchaeota and in Nanoarchaeum equitans. Also, they are absent from the Bacteria and Eukaryota. All of the Archaea that have ... summary, MM2281 catalyzed significant transfer of 14 C-label from b-alanine to pantothenate in presence of pantoate and ADP. When pantoate was removed, the resulting pantothenate–b-alanine exchange ... XL1Blue (Stratagene) using Pfu polymerase and the primers dCGCGCCTCG AGGAGGAGTCACGTTATGTTAATTA TCGAAACC and dGCGCGTCTAGATTACGCCAGCTC GACCATTTT. The PCR product was inserted into pBlue- script KS (Stratagene)...

Ngày tải lên: 07/03/2014, 05:20

... H. Akama, M. Sato, M. Nakagawa and N. Makoshi. 2004. Tele-Synopsis for Biblical Research: Development of NLP based Synoptic Software for Text Analysis as a Mediator of Educational Technology and Knowledge ... follows the Markan narrative in his own gospel he follows painstakingly the Markan order”, and hence “deviations in the order of the material must therefore be regarded as indications that Luke is ... listed in Table 2, yielding two models, B and J. Table 3 shows the increasing accuracy of both models in describing the text reuse in L train as more features are incorporated. The Block fea- ture...

Ngày tải lên: 08/03/2014, 02:21

... ordinarily taken to be a one-place predicates turns into a two-place predicate that takes individuals and times as its arguments. The variable t r occurs as a free variable in (23) and stands ... of a Meaning Representation Language for JANUS'. In: Research and Development in Natural Language Understanding as Part of th ee Strategic Computing Program, Annual Technical Report ... of temporal interpretation. 6 Evaluating Time-dependent Predicates in Context Objects and certain of their properties can receive or maintain salience in a discourse in any number of ways....

Ngày tải lên: 08/03/2014, 18:20