a uml based design tool

... software systems [ARGO03] It supports the standard UML diagrams like class diagram, state class diagram, use case class diagram, activity class diagram, and collaboration class diagram In addition, ... and a UML- based CASE tool to achieve the research objectives Several contributions are made in this project: A UML- Based Tool for Designing HLA Federates 1) Research and design a basic federate ... structure ArgoUML can generate the skeletal Java source code for class or interface based on the UML class diagrams ArgoUML provides the abstract class: Generator and one subclass: GeneratorJava to...

Ngày tải lên: 26/09/2015, 10:51

... Adequate translation into Swedish was undertaken in several steps following standard international principles A team of medically educated individuals, whose native language was Swedish translated ... questionnaire English words as abdomen, stomach, and pain can be accurately translated into Swedish in various ways We compared the back-translation with the original English version and found a few ... questionnaire Kappa values and overall agreement were measured The clinical diagnoses were made after common clinical practice, normally used at the specialists' clinic and before any laboratory or endoscopic...

Ngày tải lên: 18/06/2014, 19:20

... performance of a design point: (1) by simulation and (2) by analytical methods Simulation -based approaches permit a more detailed performance evaluation than formal analyses as the behavior and ... evaluation Finally, any selected implementation can be automatically mapped efficiently onto an FPGA -based platform library are either written by hand using a hardware description language or can ... algorithms automatically to an FPGA platform Compaan/Laura [18] automatically converts a Matlab loop program into a KPN network This process network can be transformed into a hardware/software system...

Ngày tải lên: 22/06/2014, 19:20

... individual, and group of evaluators) to evaluate various aspects of the web -based learning environment (e.g., individual and group learning activities) As a formative evaluation process, Dick & Carey ... Accuracy was based on the occurrence of acceptable ideas in the participant’s responses To compute a score for a participant, initial knowledge and recall were measured by the participant’s ability ... They argue that measuring the impact of media on learning is futile in comparison studies For example, Lockee et al maintain that media comparison studies are badly flawed because of a lack of randomization...

Ngày tải lên: 29/06/2014, 02:20

... different design alternatives and tune their application constantly The often non-availability of real hardware is a particularly serious challenge Because the target hardware and the software are ... highlyreconfigurable simulator provides a fast and accurate performance evaluation tool to aid both software and hardware design • We proposed a UML profile for the software portion of BSN applications, and ... is YAML[84] YAML uses UML notations to model hardware and allows user to input information about objects and relationships into a UML class diagram (for behavioral hierarchy) and object diagram(for...

Ngày tải lên: 09/09/2015, 18:57

... knowledge -based report generator, occur at one of the higher cognitive gtrata (p _ l.setparams (goal "stat act "op setparams) (remove 1) (make paramsyllables "val 30) (make parammessages "val 3) (make ... generator Research in machine translations and text understanding9 has demonstrated that not only does naturally generated text disclose the lexicon and grammar of a sublanguage, but it also reveals ... uncomplicated task of grouping messages into paragraphs, ordering messages within paragraphs, and assigning a priority number to each message Priorities are assigned as a function of topic and subtopic...

Ngày tải lên: 21/02/2014, 20:20

... evaluation, common in the machine translation domain and already used for paraphrase evaluation (Bannard and Callison-Burch, 2005) The question asked to the human evaluator for the syntactic task ... because a statistical paraphrase table, an analogical solver and a paraphrase memory for instance; there is no constraint on the scoring function because it only scores final states Note that ... state-of-the-art to generate paraphrases Colin Bannard and Chris Callison-Burch 2005 Paraphrasing with bilingual parallel corpora In Annual Meeting of ACL, pages 597–604, Morristown, NJ, USA Association...

Ngày tải lên: 17/03/2014, 02:20

... statistical machine translation methods acquire their translation knowledge in form of large phrase translation tables automatically from large amounts of translated texts (Koehn et al., 2003) For each ... computer aided translation tool caitra that allows us to compare industrystandard post-editing, the interactive sentence completion paradigm, and other help for translators The tool is available ... words and advanced users with suggestions that are not part of their active vocabulary It may be possible that these options even allow users that not know the source language to create a translation,...

Ngày tải lên: 17/03/2014, 02:20

... for fabrics in apparel and textiles? Chances are, the people managing apparel and textile businesses in Brown County have no idea of what is taking place with advanced materials in Owen and Lawrence ... regional economy The data enable a practitioner to extend and deepen the analysis of a region Example: Understanding Regional Basic Employers With data provided by the tool, users can create a matrix ... metropolitan areas Data-Driven Strategies To be successful with a regional strategy, local leaders face a number of challenges: designing a process of collaboration, defining the practical boundaries...

Ngày tải lên: 17/03/2014, 10:20

... Extraction (IE) tasks (Figure 2) Additional aspects of annotations can be marked using attributes, binary or multi-valued flags that can be added to other annotations Finally, annotators can attach ... Learning, pages 152–164 Association for Computational Linguistics Hamish Cunningham, Diana Maynard, Kalina Bontcheva, Valentin Tablan, Niraj Aswani, Ian Roberts, Genevieve Gorrell, Adam Funk, Angus ... from statistical and machine learning methods to support the annotation process while still involving human annotator judgement for each annotation As a specific realisation based on this approach,...

Ngày tải lên: 17/03/2014, 22:20

Ngày tải lên: 22/03/2014, 23:21

... Postgraduate Award and a Social Sciences and Humanities Research Council of Canada Doctoral Fellowship 474 Delivering Health Education via the Web: Design and Formative Evaluation REFERENCES Agostinho, ... Education via the Web: Design and Formative Evaluation The Health and Health Behaviour subject was chosen as an appropriate subject in which to implement a Web -based learning environment and ... page (in cases were a questionnaire served as a basis for group discussion); and, a ‘Discussion Area’ For each activity, a single graphic was selected and placed at the top left corner of each...

Ngày tải lên: 28/03/2014, 21:20

... cellular automata, and other phenomena related to CPAs, with a variety of tools for data analysis, performance evaluation, and algorithm development APRON software is written to take advantage of ... uses a hardware device and APRON as a software interface or graphical user interface to the hardware 4.2 Modelling ASPA in APRON The ASPA vision chip [5] is a digital cellular processor array, ... and algorithms All APRONScript code can be checked for syntax errors and validated automatically The scripting language does not require variable declaration and operates on an assumption that...

Ngày tải lên: 21/06/2014, 22:20

... trial evaluating falls and osteoporosis risk management strategies Trials 2008, 9(1):62 39 Public Health Agency of Canada Canada’s Aging Population: Who are Canada’s Seniors? Division of Aging and ... constant comparative approach will be used to group the codes into categories and identify themes Quantitative analysis of accompanying questionnaire data will be analyzed using analysis of variance ... controlled trial Page of Acknowledgements The study was funded by a Canadian Institutes of Health Research (CIHR) Operating grant Author details Department of Health Policy, Management and Evaluation,...

Ngày tải lên: 10/08/2014, 11:20

... studied by Pandey et al [39] (Table 2): three gamma-proteobacteria (E coli as an AT-rich generic model, Coxiella burnetii as an obligate host-associated organism and Pseudomonas aeruginosa as a free ... given bacterial genome: Rapid Automated Scan for Toxins and Antitoxins in Bacteria (RASTA-Bacteria) This method is based on the genomic features associated with toxins and antitoxins and the existence ... genome architecture (it works with linear and circular chromosomes from to less than Mb, megaplasmids, plasmids), G+C content, bacterial classification (Gram+ and GramEubacteria, Archaea), and lifestyle...

Ngày tải lên: 14/08/2014, 08:20

... ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA CTCAAAAGCCTTTGAGCAGCAACTTCTTGATATGGGAGCAAAAGT TTCAAAAACTTTCAACAAGCGCGTGACACATGTAGTCTTCAAAGA TGGACATTCAACTACATGGAGAAAAGCACAGGATGCTGGTGTAAA blastn blastx tblastx Protein Coding Region Start ... 19824860 957488 ACTCGAGGATGACACTTCGGCCGATGAGGTACAAGTTTCTTCTATTTGTTTTGGAATAAAGTGTAATCGCCGTGCTTAATGATTTTCCCACAATCGATCAGCAGGATAAGGAGATTGATCTGCCAGAGTCCATT ACTCGAGGATGACACTTCGGCCGATGAG>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>>CAGGATAAGGAGATTGATCTGCCAGAGTCC ... add Clear User-Defined Exons Table mRNA (1802 nucleotides) AGCACCGCGCAGGCGCTGCGGAGCCGCGCGGAGGAAGTTTGAACG GTGGCGGGTACCGGAGCCGCTGATGGAGTCCGTGCTGAAAGGTAT ATGTGCATTTGTAGAAGTTTGGTCATCTAGCAGAACAGAAAATTA...

Ngày tải lên: 14/08/2014, 16:21

... Biology 2007, Additional data files The following additional data are available with the online version of this article Additional data file contains an illustrative example of the GENECODIS algorithm ... operation Additional data file contains the results obtained by GENECODIS in the analysis of the yeast and human gene sets Additional data file provides a description of a comparative analysis ... example genes that are differentially expressed among pathologic and normal tissues These data can provide a basis for the characterization of unknown genes, and at the same time they are also...

Ngày tải lên: 14/08/2014, 17:22

... analytical tool wear models and built tool wear rate maps based on Kannatey et al.[110] to estimate the tool wear However, such wear rate maps are accurate only if the diffusion and adhesion parameters ... tangential, radial and axial direction elemental cutting force in Cartesian co-ordinates tangential, radial and axial edge force coefficients tangential, radial and axial cutting force coefficients angle ... and flank face, plastic deformation at shear zone, crack formation and propagation, impact of chip at workpiece and chip breakage AE signals are mostly used to detect tool breakage in literature...

Ngày tải lên: 14/09/2015, 08:39

... performance and fairness cannot be adequately captured with a limited mathematical framework, such as the one proposed by Fan et al 1.1 Our Approach Therefore, we propose a new taxonomy -based approach ... utilize the available capacity In BitTyrant, it is a dynamic number based on the some calculation of the upload/download ratio of the neighbours and the local peer’s own upload capacity PropShare unchokes ... PropShare is Sybil-proof and collusion-resistant However, the PropShare client needs to know its initially available upload capacity and only thereafter can it allocate a preset upload quota for each...

Ngày tải lên: 26/09/2015, 10:44

... Sequence diagrams Class and object diagrams are static model views Interaction diagrams are dynamic They describe how objects collaborate A sequence diagram is an interaction diagram that details how ... at the receiver interface of a MAC controller 2.2.3 Activity Diagrams Activity Diagrams are used for dynamic descriptions of behavioural designs An activity graph is a variation of a state machine ... various messages 1.2.7 Activity diagrams An activity diagram is essentially a fancy flowchart While a statechart diagram focuses attention on an object undergoing a process (or on a process as an object),...

Ngày tải lên: 26/09/2015, 10:51