a toy for self expression

Tài liệu Báo cáo khoa học: "A Tool for Multi-Word Expression Extraction in Modern Greek Using Syntactic Parsing" pdf

Tài liệu Báo cáo khoa học: "A Tool for Multi-Word Expression Extraction in Modern Greek Using Syntactic Parsing" pdf

... Greek are special noun phrases, called lexical phrases (Anastasiadi-Symeonidi, 1986) or loose multi-word compounds (Ralli, 2005): - Adjective+Noun: anoiqt  θˆlassa (anichti thalassa, ’open sea’), ... translation In Proceedings of MT Summit X, pages 79–86, Phuket, Thailand Validation The tool also provides functionalities allowing users to create a database of manually validated MWEs from among ... is also automatically found, highlighted and displayed next to the original context (see Figure 1) Thus, users can see how a MWE has previously been translated in a given context Anna Anastasiadi-Symeonidi...

Ngày tải lên: 22/02/2014, 02:20

4 491 0
Báo cáo " Training students’ self-expression in English through portfolio assessment: A trial in English literature " pptx

Báo cáo " Training students’ self-expression in English through portfolio assessment: A trial in English literature " pptx

... ideas in a logical and readable way can be considered the main obstacle.” [Mai Anh] Class discussions and presentations also reveal the same problem with spoken English Invaluable practice and ... when he was left alone at the end of the chapter was not a signal of weakness but an indication of humanity Jordan is a beloved character to readers not only because of his great sacrifice for others ... inter-personal relations, etc - a 227 relational language.” (p.212) Savignon (2002, p.5) suggests that learners’ self- expression can be encouraged by promoting personal language use, which means teachers...

Ngày tải lên: 05/03/2014, 12:20

8 365 1
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC TCATCTCTGAAGAGGATCTG-3¢) and (5¢-GCATG CCTGCAGGTCGACTCTAGAGGATCTCAAGCCAGT GACCGCCTCCC-3¢); for Golf (5¢-GGTACCGCTGCAA TGGGGTGTTTGGGCAAC-3¢) and (5¢-GCGGCCGCCT CAGATCACAAGAGTTCGTACTGC-3¢); ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-GCATGCCTGCAGG TCGACTCTAGAGGATCTCAAGCCAGTGACCGCCT...

Ngày tải lên: 07/03/2014, 16:20

14 473 0
A Monthly Struggle for Self-Control? Hyperbolic Discounting, Mental Accounting, and the Fall in Consumption Between Paydays ppt

A Monthly Struggle for Self-Control? Hyperbolic Discounting, Mental Accounting, and the Fall in Consumption Between Paydays ppt

... reasonable parameter values, the model can generate a decline that matches the data We assume δ = 1, which is reasonable over a week or a day, and an annual interest rate of r = 0.03 In the case ... 47-68 Ariely, Dan and Klaus Wertenbroch (2002) “Procrastination, Deadlines, and Performance: Self- Control by Precommitment,” Psychological Science, May, 13, 219-224 Ashraf, Nava, Dean S Karlan, and ... University of California, Berkeley, Manuscript DellaVigna, Stefano and M Daniele Paserman (2005) “Job-Search and Impatience,” Journal of Labor Economics, July Fang, Hanming and Daniel Silverman (2004)...

Ngày tải lên: 23/03/2014, 03:20

58 345 0
Order In Chaos - A Spiritually Inspirational Self-help Book Of Devotions And Meditations For Christianity.pdf ppt

Order In Chaos - A Spiritually Inspirational Self-help Book Of Devotions And Meditations For Christianity.pdf ppt

... that fasting is a denial of the flesh, a constant prayer, and that we it everyday anyways? (Refer to break-fast) Also, fasting is ... that God set up a system for nature to gov- ern itself, whereas mankind was in itself the unique of all crea- tion I believe that He could have ... dark white, probably because generations of my ancestors lived in cloudy areas of Europe, whereas some people are darker, and have genealogies...

Ngày tải lên: 29/03/2014, 00:20

75 412 0
intech-a method for project member role assignment in open source software development using self organizing maps

intech-a method for project member role assignment in open source software development using self organizing maps

... process Table Input data format (knowledge and skill for software development) 62 62 Table Experimental input data Self Organizing Maps - Applications and Novel Algorithm Design Self Organizing Maps ... 60 60 Self Organizing Maps - Applications and Novel Algorithm Design Self Organizing Maps - Applications and Novel Algorithm Design Wiki are evaluated by all the members of other layers If agreement ... skill Basis of software design Main problems of software design Structure and architecture Analyses and evaluation of software designing quality A notational system of software design Tactics and...

Ngày tải lên: 28/04/2014, 10:14

14 366 0
intech-a method for project member role assignment in open source software development using self organizing maps

intech-a method for project member role assignment in open source software development using self organizing maps

... we can estimate the winding parameters ( and ) and damper parameters ( and ) The and got from standstill test data may not be accurate enough for online model, but it can be used as initial values ... operation, we can easily measure phase voltage and But we cannot measure the magnephase current and the damper winding current Let’s tizing current assume that the phase parameters and obtained ... unaligned position does not change much with the phase current and can be treated as a constant The inductances at midway and aligned position LU et al.: NEURAL NETWORK-BASED MODELING AND PARAMETER...

Ngày tải lên: 28/04/2014, 10:17

7 400 0
Báo cáo toán học: " A note on the almost sure limit theorem for self-normalized partial sums of random variables in the domain of attraction of the normal law" pptx

Báo cáo toán học: " A note on the almost sure limit theorem for self-normalized partial sums of random variables in the domain of attraction of the normal law" pptx

... this article is to study and establish the ASCLT for self- normalized partial sums of random variables in the domain of attraction of the normal law, we will show that the ASCLT holds under a fairly ... partial sums were obtained by Lacey and Philipp [4], Ibragimov and Lifshits [5], Miao [6], Berkes and Cs´ ki [7], H¨ rmann [8], Wu [9, 10], and Ye and Wu [11] Huang and Zhang [12] and Zhang a ... identically distributed random variables in the domain of attraction of a normal distribution A universal result in almost sure limit theorem for the self- normalized partial sums S n /Vn is established,...

Ngày tải lên: 20/06/2014, 21:20

13 481 0
Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc

Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc

... using random hexamer primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense ... (CGCACACAGTAGTCCCCGG) primers were used For GAPDH we used CCCTTCATTGACCTCAACTACATGG (sense) and GGTCCACCACCCTGTTGCTGTAGCC (antisense) as primers Reverse transcription PCR was carried out using an ... system Nat Rev Immunol 2002, 2:725-734 Das J, Chen CH, Yang L, Cohn L, Ray P, Ray A: A critical role for NF-kappa B in GATA3 expression and TH2 differentiation in allergic airway inflammation Nat...

Ngày tải lên: 09/08/2014, 07:20

10 462 0
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps

Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps

... Probes and primer sequences used Gene Primers and probes 11β-HSD1 Forward primer: AGGAAAGCTCATGGGAGGACTAG Reverse primer: ATGGTGAATATCATCATGAAAAAGATTC Probe: CATGCTCATTCTCAACCACATCACCAACA H6PDH Forward ... H6PDH Forward primer: CAGGTGTCCTAGTGCACATTGAC Reverse primer: GTAGCCCACTCTCTCGTCCAA Probe: AAGGCACGCCCTCCCAGCG GRα Forward primer: GCGATGGTCTCAGAAACCAAAC Reverse primer: GAGATTACAGAGGAAGTTATCCTCTGC ... Probe: TGCAGTGAAGGTTGCTGAGGCTCTGA GRβ Forward primer: AAC TGG CAG CGG TTT TAT CAA CT Reverse primer: AACTCTTGGATTCTATGCATGAAAATGTTA TGTGGTTA Probe: TGT GTG AGA TGT GCT TTC TGG TT C/EBPα Forward primer:...

Ngày tải lên: 09/08/2014, 08:22

10 438 0
Báo cáo y học: "A scaling normalization method for differential expression analysis of RNA-seq data" pps

Báo cáo y học: "A scaling normalization method for differential expression analysis of RNA-seq data" pps

... statistical analysis (for example, Fisher’s exact test; see Materials and methods for more details) Normalization factors across several samples can be calculated by selecting one sample as a ... BioMart and Bioconductor: a powerful link between biological databases and microarray data analysis Bioinformatics 2005, 21:3439-3440 CRAN - Package statmod [http://cran.r-project.org/web/packages/statmod/ ... are similar to the assumptions commonly made in microarray normalization procedures such as lowess normalization [21] and quantile normalization [22] Therefore, adequately normalized array data...

Ngày tải lên: 09/08/2014, 20:21

9 518 0
báo cáo khoa học: "Combinatorial peptidomics: a generic approach for protein expression profiling" potx

báo cáo khoa học: "Combinatorial peptidomics: a generic approach for protein expression profiling" potx

... separate spectra from each of the samples were obtained by accumulation of data from 400 laser shots Peak areas were measured for each peak on each spectrum and average values were expressed as ... suitable for use with a variety of platforms, including traditional systems (columnbased co-IP), arrayed affinity reagents (antibody microarrays, e.g on MALDI plates) and a variety of micro- and ... Met-reactive beads All spectra were obtained under identical MS settings and all other details were the same Values for each individual peptide were calculated as individual peak areas taken relative...

Ngày tải lên: 11/08/2014, 00:22

15 278 0
Báo cáo y học: "Snow Control - An RCT protocol for a web-based self-help therapy to reduce cocaine consumption in problematic cocaine users" pps

Báo cáo y học: "Snow Control - An RCT protocol for a web-based self-help therapy to reduce cocaine consumption in problematic cocaine users" pps

... the data analyses and counted as dropout (cut-off: answered at least 70% of the questions) Data Analysis Data will be analysed according to the intention-to-treat principle Multiple imputations ... or a professional from Page of the medical advisory and emergency list that will be accessible at all times and how to make this contact The participants will also be informed that the study has ... the presentation of a consumption diary first After having read each of the information modules, the participants are invited to participate in a weekly quiz to evaluate their information knowledge...

Ngày tải lên: 11/08/2014, 15:22

7 402 0
Báo cáo sinh học: "ANMM4CBR: a case-based reasoning method for gene expression data classification" docx

Báo cáo sinh học: "ANMM4CBR: a case-based reasoning method for gene expression data classification" docx

... normalization method as in [19], which includes base 10 log-transformation as well as normalization to mean and variance For the data that contains negative values, we not perform log-transformation ... approach and the classifier List of abbreviations ANMM4CBR: additive nonparametric margin maximization for case-based reasoning; ANMM: additive nonparametric margin maximization; NMM: nonparametric ... contains two modules, ANMM for feature selection and CBR for classification Both ANMM and CBR are suitable for dealing with microarray data, which usually contain noisy information and only a small...

Ngày tải lên: 12/08/2014, 17:20

11 373 0
Báo cáo y học: " APOBEC3G-UBA2 fusion as a potential strategy for stable expression of APOBEC3G and inhibition of HIV-1 replication" pot

Báo cáo y học: " APOBEC3G-UBA2 fusion as a potential strategy for stable expression of APOBEC3G and inhibition of HIV-1 replication" pot

... plasmid pcDNA3.1HHR2 3A by PCR The 5' primer used was 5'ATCCAAGACGGAATTCACGCCGCAGGAGAAAGAAGCTATAG-3'; the 3' primer for the APOPEC3G-UBA2 fusion was 5'-ATCGTACTCGAAGCTTCTAACTCAGGAGGAAGTTGGCAG-3'; ... the E plasmid was 5'-ATCCAAGACGGAATTCCTAGAACTCGTTTTCCTGATTCTGGAG-3' and the 3' primer used for the U and M plasmid was 5'-ATCCAAGACGGAATTCGTTTTCCTGATTCTGGAG-3' The UBA2 gene fragment was amplified ... essential for Vif function J Biol Chem 2005, 280(19):18573-18578 Shirakawa K, Takaori-Kondo A, Kobayashi M, Tomonaga M, Izumi T, Fukunaga K, Sasada A, Abudu A, Miyauchi Y, Akari H, Iwai K, Uchiyama...

Ngày tải lên: 13/08/2014, 05:21

13 254 0
Báo cáo y học: "Down-regulation of kallikrein-related peptidase 5 (KLK5) expression in breast cancer patients: a biomarker for the differential diagnosis of breast lesions" doc

Báo cáo y học: "Down-regulation of kallikrein-related peptidase 5 (KLK5) expression in breast cancer patients: a biomarker for the differential diagnosis of breast lesions" doc

... 5’-CCGGTGACAAAGCAGGTAGAG-3’ and reverse 5’-GTGAACTTGCAGAGGTTCGTGTA-3’ pair of primers, whereas the use of the HPRT1 forward 5’TGGAAAGGGTGTTTATTCCTCAT-3’ and reverse 5’-ATGTAATCCAGCAGGTCAGCAA-3’ primers ... (KLK5) expression in breast cancer patients: a biomarker for the differential diagnosis of breast lesions Margaritis Avgeris1, Georgia Papachristopoulou1,2, Athanasios Polychronis2 and Andreas Scorilas1* ... and the HPRT1 reference gene sequences were amplified in separate duplicate reactions for each sample and the average CT value was calculated Relative quantification analysis, using the comparative...

Ngày tải lên: 13/08/2014, 13:20

12 340 0
Báo cáo y học: "A method for high-throughput gene expression signature analysis" ppt

Báo cáo y học: "A method for high-throughput gene expression signature analysis" ppt

... (RASL) and DNA-mediated annealing, selection and ligation (DASL) are ligation-based methods that rely on self- assembled fibreoptic bead arrays for detection [11,12] Although these approaches have ... neuroblastoma signature, 191 wells: 99.5% accuracy; data not shown) Taken together, these data indicate that LMF represents a highly accurate signature analysis method that is suitable for high-throughput ... Additional data file 6); a document containing raw LMF data used to assess the stability of the LMF method (in the tab-delimited txt file format; Additional data file 7); and a document containing raw...

Ngày tải lên: 14/08/2014, 16:21

6 269 0
Báo cáo y học: "A consensus prognostic gene expression classifier for ER positive breast cancer" pptx

Báo cáo y học: "A consensus prognostic gene expression classifier for ER positive breast cancer" pptx

... JD, Caldas C: A variational Bayesian mixture modelling framework for cluster analysis of gene -expression data Bioinformatics 2005, 21:3025-3033 Naderi A, Ahmed AA, Barbosa-Morais NL, Aparicio ... KY, Fraley C, Murua A, Raftery AE, Ruzzo WL: Model-based clustering and data transformations for gene expression data Bioinformatics 2001, 17:977-987 Teschendorff AE, Wang Y, Barbosa-Morais NL, ... two-stage mixture modeling of microarray data BMC Genomics 2004, 5:94 Parmigiani G, Garrett ES, Anbazhagan R, Gabrielson E: A statistical framework for expression- based molecular classification...

Ngày tải lên: 14/08/2014, 17:22

13 353 0
Báo cáo y học: "At-TAX: a whole genome tiling array resource for developmental expression analysis and transcript identification in Arabidopsis thaliana" pps

Báo cáo y học: "At-TAX: a whole genome tiling array resource for developmental expression analysis and transcript identification in Arabidopsis thaliana" pps

... GeneChip® Arabidopsis Tiling 1.0R Array for routine expression analyses does not have any apparent disadvantages compared with the ATH1 array Rather, it has many advantages, including the ability ... thaliana Tiling Array Express' (At-TAX), using RNA To compare the expression values derived from ATH1 array and tiling array, we generated scatter plots and calculated pair-wise Pearson correlation ... both cases Here, we use the Affymetrix GeneChip® Tiling 1.0R Array (Affymetrix Inc., Santa Clara, CA, USA) to provide an initial whole-genome expression atlas for A thaliana, dubbed 'Arabidopsis...

Ngày tải lên: 14/08/2014, 20:22

16 265 0
Work environment as a motivating factor for self  improvement of english A case study of projects in cảe internatinal in viet Nam

Work environment as a motivating factor for self improvement of english A case study of projects in cảe internatinal in viet Nam

... Vietnam Another reason is that the author has been a part of the “natural setting” She has been working in CARE International in Vietnam for one year and a half This case study uses both qualitative ... University of East Anglia, pp.45-61 Australian National Training Authority, (2003), What makes for good workplace learning, National Centre for Vocational Education Research Ltd Baloto, F (1996), ... an illustration, education and learning is a life-long process and in any environment, even after graduation or not in an educational setting, learning is always taking place and motivation for...

Ngày tải lên: 04/08/2015, 09:42

11 443 0
w