a toy example of exception handling

Báo cáo sinh học: " A new example of viral intein in Mimivirus" ppt

... DNA polymerase II (PolII), bacterial DNA polymerase III α subunit (DnaE) and bacteriophage DNA polymerase I Among these, archaeal PolI belongs to the family B DNA polymerase Archaeal PolI contains ... KFVKPVSLEFEKVYYPYLLI -AEAMALGREAADWVSG HFPSPIRLEFEKVYFPYLLI -MKTIAKCQRAAKLINQ NVPKPQSIVYEKTLHPFILV - : : :: Sequence alignment of Family B DNA polymerases from the Archaea, Bacteria and Eukarya domains ... 7-missmaches (TATATTGAC/ACTGATGGA; MJ0885) and mismatches (TATATAGAC/ACGGATGGA; PH1947), respectively To the best of our knowledge, no evidence has been reported for a homing endonuclease recognizing...

7
435
0

báo cáo hóa học:" A new example of viral intein in Mimivirus" potx

Danh mục: Hóa học - Dầu khí

... DNA polymerase II (PolII), bacterial DNA polymerase III α subunit (DnaE) and bacteriophage DNA polymerase I Among these, archaeal PolI belongs to the family B DNA polymerase Archaeal PolI contains ... KFVKPVSLEFEKVYYPYLLI -AEAMALGREAADWVSG HFPSPIRLEFEKVYFPYLLI -MKTIAKCQRAAKLINQ NVPKPQSIVYEKTLHPFILV - : : :: Sequence alignment of Family B DNA polymerases from the Archaea, Bacteria and Eukarya domains ... 7-missmaches (TATATTGAC/ACTGATGGA; MJ0885) and mismatches (TATATAGAC/ACGGATGGA; PH1947), respectively To the best of our knowledge, no evidence has been reported for a homing endonuclease recognizing...

7
321
0

Báo cáo y học: "Association of the FCRL3 gene with rheumatoid arthritis: a further example of population specificity" ppsx

Danh mục: Báo cáo khoa học

... deiminase 4, are associated with rheumatoid arthritis Nat Genet 2003, 34:395-402 Ikari K, Kuwahara M, Nakamura T, Momohara S, Hara M, Yamanaka H, Tomatsu T, Kamatani N: Association between PADI4 and ... Suzuki A, Yamada R, Chang X, Tokuhiro S, Sawada T, Suzuki M, Nagasaki M, Nakayama-Hamada M, Kawaida R, Ono M, et al.: Functional haplotypes of PADI4, encoding citrullinating enzyme peptidylarginine ... Ikari K, Momohara S, Inoue E, Tomatsu T, Hara M, Yamanaka H, Kamatani N: Haplotype analysis revealed no association between the PTPN22 gene and RA in a Japanese population Rheumatology (Oxford)...

5
406
0

Chapter 27: An Introduction to PL/SQLThe Exception Handling section of a PL/SQL block is pot

Danh mục: Cơ sở dữ liệu

... commands from within the package (such as calls from other procedures) Examples of packages are shown in “create package Syntax,” later in this chapter Packages may also include commands that are ... use a database event trigger to perform system maintenance functions immediately after each database startup For example, the following trigger pins packages on each database startup Pinning packages ... 28:517 Chapter 28: Triggers For example, you may want to create and maintain a second copy of your application’s audit log By doing so, you safeguard against a single application erasing the audit...

108
588
0

Báo cáo khoa học: A strategy for the generation of speciﬁc human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Danh mục: Báo cáo khoa học

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

11
679
0

Báo cáo y học: "What do we know about communicating risk? A brief review and suggestion for contextualising serious, but rare, risk, and the example of cox-2 selective and non-selective NSAIDs" pot

Danh mục: Báo cáo khoa học

... J, Saperas E, Santolaria S, Rodrigo L, Balanzo J, Bajador E, Almela P, Navarro JM, Carballo F, Castro M, Quintero E, Investigators of the Asociacion Espanola de Gastroenterologia (AEG): A nationwide ... available to allow the appropriate calculations As the rather disparate examples in Figures to show, it is unusual to have a coherent set of data available for a single topic because the amount ... rate of in 1,000 persons a year, although at age 60 years a higher rate of about or per 1,000 would apply, similar to that of a large survey in Spain [71] A cohort study in Canada [7] showed matched...

16
463
0

Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country pdf

Danh mục: Báo cáo khoa học

... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... transfer activities as equal weight for various cases is a simple and optional approach Linear regression analysis was done by entering all variables into the model This type of analysis was...

8
341
0

báo cáo khoa học: " Knowledge transfer in Tehran University of Medical Sciences: an academic example of a developing country" pot

Danh mục: Báo cáo khoa học

... Sex (male/female) Associate professor (in comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic ... comparison to an assistant professor) Professor (in comparison to an assistant professor) Instructor (in comparison to an assistant professor) Non-academic member (in comparison to an assistant ... transfer activities as equal weight for various cases is a simple and optional approach Linear regression analysis was done by entering all variables into the model This type of analysis was...

8
315
0

Báo cáo y học: "Is obesity a risk factor for low back pain? An example of using the evidence to answer a clinical question" ppsx

Danh mục: Báo cáo khoa học

... data should anyone wish to examine the source As an example of an evidence summary see Table It is at this time that the clinician is ready for the final step of applying the evidence In our example ... (1976), in a review of 144 cases, found that 70% of those who complained of low back pain had been classified as being overweight [19] This basic research appeared to conclude what was already intuitively ... 40 are at a high risk of developing low back pain Albeit controversial, Table may lead to a further refinement of risk of osteoarthritis and low back pain based solely on BMI Limitations of obesity...

6
402
0

A study on an example of non-verbal interaction between the presenter and audience for English majored students at the School of Foreign Language

Danh mục: Sư phạm

... pp.19-26 Al-Issa, A (200 7a) English language teaching at the College of Law-Muscat, Sultanate of Oman: Analyzing needs and understanding problems Asian Journal of English Language Teaching, 17, ... than other forms of research Questionnaire is easy to analyze Data entry and tabulation for nearly all surveys can be easily done with many computer software packages Questionnaire is familiar ... has the capacity for great variety and advantages Varying vocal qualities adds interest and meaning to the messagesof the presenters The vocal characteristics of rate, volume, clarity, etc All...

50
454
2

XỬ LÝ NGOẠI LỆ (Exception Handling)

Danh mục: Kỹ thuật lập trình

... 7.3 class ArraySizeException extends NegativeArraySizeException { ArraySizeException() // constructor { super(“You have passed an illegal array size”); } } class ThrowDemo { int size, array[]; ... ArthmeticException IllegalAccessException IllegalArgumentException ArrayIndexOutOfBoundsExeption NullPointerException SecurityException ClassNotFoundException NumberFormatException AWTException IOException ... lệ: 34 Core Java public class Example { // multiple exceptions separated by a comma public void exceptionExample() throws ExException, LookupException { try { // statements } catch(ExException exmp)...

12
864
3

A Designated Center of Academic

Danh mục: Phần cứng

... of thread that calls it – The DLL uses the stack of the calling thread and the virtual address space of the calling process – The DLL allocates memory from the virtual address space of the calling ... Systems Programming 10 2/27/2008 Advantages of Using DLL  Some advantages over static linking – Smaller program image – Save system memory, since multiple processes can share a single copy of the ... Last Class  Memory Management – Overview – Heap management – Memory-mapped files – Dynamic link libraries CS222 - Systems Programming 2/27/2008 Today’s Class  Memory Management – Overview...

26
602
0

Exception Handling

Danh mục: Kỹ thuật lập trình

... Classes and Exceptions  Remember that an object of a derived class is also an object of the base class  If D is a derived class of B and B is in an exception specification  A thrown object of ... that happens to be used as an exception class An example of a program with a programmer defined exception class is in Display 16.3 (1-2) Copyright © 2007 Pearson Education, Inc Publishing as ... you place the code that deals with the exceptional case This is called handling the exception Copyright © 2007 Pearson Education, Inc Publishing as Pearson Addison-Wesley Slide 16- A Toy Example...

55
428
0

Cambridge.University.Press.A.Student.Grammar.of.Spanish.Feb.2006.pdf

Danh mục: TOEFL - IELTS - TOEIC

... -ie and -sis are feminine: 13 A STUDENT GRAMMAR OF SPANISH -ma (el) asma la cama la crema (M) la estratagema la forma asthma bed cream stratagem form la gema la lima la trama la yema agility anxiety ... uncouth man, brute head of an organization 21 A STUDENT GRAMMAR OF SPANISH calavera c´ mara a caza cura espada facha g´nesis e gu a ı ma˜ ana n meta pareja recluta vig a ı skull camera hunt cure ... siguiente parrafo en voz alta y en clase, e indica el uso de la sinalefa Al escribir ´ las palabras, pon un , o sea subrayando el espacio entre las palabras apropiadas o dentro de una palabra: A trav´...

354
1,462
8

A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf

Danh mục: Quản trị kinh doanh

... MacDonald can be said to have a larger degree of dispersion of data around the mean than Max hamburger in those attributes Max hamburger had a larger standard deviation than MacDonald in these attributes“its ... was clear and well dressed neat and trained staffs” Therefore MacDonald can be said to have a larger degree of dispersion of data around the mean than Max hamburger in those attributes Max hamburger ... jingle: a slogan is a visible feature of a brand There can be a strong link between a slogan and a brand The slogan and jingle are powerful and can be a great change for a brand • Be different and...

88
986
8

Express Publishing A Good Turn Of Phrase

Danh mục: Ngữ pháp tiếng Anh

...

98
655
5

Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"

Danh mục: Y học thưởng thức

... be statistically significant at a 10% level in the univariate analysis and subjected to multivariate Cox regression analysis: lactate, APACHE II score, SOFA score and circulating Ang-2 (Table ... Critical Care Vol 12 No Kümpers et al package (SPSS Inc., Chicago, IL, USA) and the GraphPad Prism software (GraphPad Prism Software Inc San Diego, California, USA) Figure Results Decreased Ang-1 and ... coefficient and linear regression analysis was performed after logarithmic transformation of Ang-2 values (logAng-2) The primary outcome studied was 30-day survival and was calculated from the day of...

9
634
0

Báo cáo y học: "Electronic patient record use during ward rounds: a qualitative study of interaction between medical staff"

Danh mục: Y học thưởng thức

... Intensive care unit The ICU, consisting of 25 critical care beds, is part of a specialist hospital that concentrates on all aspects of adult cardiothoracic care Approximately 70% of admissions are patients ... detailed data on particular aspects of a patient's condition and treatment – are accessible via tabs displayed across the top of the summary screen as shown in Figure A multidisciplinary team at ... place of a paper record? Given the complex nature of interaction of multidisciplinary communication in an ICU, we have chosen to triangulate three types of qualitative data: video-based interaction...

8
503
0

Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"

Danh mục: Y học thưởng thức

... board European aircraft Materials and methods This study originates from the surgical department of an academic teaching hospital (Department of General and Visceral Surgery, Augusta Krankenanstalt, ... compare the MFK of a large national European national airline with that of a lowcost (no-frills) carrier Although the national European airline had excellent equipment, intravenous medications and ... cases, 4.9%), patients with cardiac irregularities may profit from an on-board AED as part of the MFK The same is true for patients with a suspected myocardial infarction (34 cases, 0.3%) Apart...

6
639
0

Báo cáo y học: "Eosinopenia is a reliable marker of sepsis on admission to medical intensive care units"

Danh mục: Y học thưởng thức

... 51:189-197 A ssaoui Y, Zeggwagh AA, Zekraoui A, Abidi K, Abouqal R: Validation of a behavioral pain scale in critically ill, sedated, and mechanically ventilated patients Anesth Analg 2005, 101:1470-1476 ... Zeggwagh AA, Abidi K, Madani N, Abouqal R: Measurement properties of the short form 36 and health-related quality of life after intensive care in Morocco Acta Anaesthesiol Scand 2007, 51:189-197 A ssaoui ... of data NM helped to draft the manuscript, and participated in the acquisi- Page of 10 (page number not for citation purposes) tion of data AZ participated in the coordination of the study AAZ...

10
597
0