a toolbox for spatial analysis on a network

Báo cáo hóa học: " Research Article A Fluid Model for Performance Analysis in Cellular Networks" doc

Báo cáo hóa học: " Research Article A Fluid Model for Performance Analysis in Cellular Networks" doc

... (mean and standard deviation) This point is rarely raised in literature: analysis and Monte Carlo simulations can lead to quite different outage probabilities even if analytical average and variance ... for the traditional hexagonal network The simplicity of the result allows a spatial integration of the OCIF leading to closed-form formula for the global outage probability and for the spatial ... Conclusion In this paper, we have proposed and validated by Monte Carlo simulations a fluid model for the estimation of outage and spatial outage probabilities in cellular networks This approach...

Ngày tải lên: 21/06/2014, 11:20

11 477 0
CARTOGRAPHY – A TOOL FOR SPATIAL ANALYSIS pdf

CARTOGRAPHY – A TOOL FOR SPATIAL ANALYSIS pdf

... Krystyna Szyku a, Axente Stoica, Dan Savastru, Marina Tautan, Carla Bernadete Madureira Cruz, Rafael Silva de Barros, Janvier Fotsing, Emmanuel Tonye, Bernard Essimbi Zobo, Narcisse Talla Tankam, ... Chapter Chapter Web Map Tile Services for Spatial Data Infrastructures: Management and Optimization Ricardo Garc a, Juan Pablo de Castro, Elena Verdú, Mar a Jesús Verdú and Luisa Mar a Regueras ... Mathematical Analysis in Cartography by Means of Computer Algebra System Shao-Feng Bian and Hou-Pu Li Chapter Web Map Tile Services for Spatial Data Infrastructures: Management and Optimization...

Ngày tải lên: 28/06/2014, 10:20

324 434 0
Security Monitoring: Proven Methods for Incident Detection on Enterprise Networks ppt

Security Monitoring: Proven Methods for Incident Detection on Enterprise Networks ppt

... policy Example: Monitoring HIPAA applications for unauthorized activity Title II of HIPAA addresses security and privacy of health data Among many other safeguards, it states that “Information systems ... United States or Canada) 707-829-0515 (international or local) 707-829-0104 (fax) We have a web page for this book, where we list errata, examples, and any additional information You can access ... create a watermark against the traffic that will be measured Sustained statistical deviations above or below that watermark are triggers for the tool to analyze the traffic further and produce an...

Ngày tải lên: 22/03/2014, 21:20

248 856 0
ICT enabled independent living for elderly: A status-quo analysis on products and the research landscape in the field of Ambient Assisted Living (AAL) in EU-27 doc

ICT enabled independent living for elderly: A status-quo analysis on products and the research landscape in the field of Ambient Assisted Living (AAL) in EU-27 doc

... investigations on the current European research landscape for AAL and again prove a certain lack of international consolidation To give a common example, certain expressions which http://www.aal-europe.eu/contacts, ... individual’s hearing ability It also makes available different information about equipment already on the market and gives general information for example to family members Via an ePlatform, these ... primarily a data collection task force The project developed a “multidisciplinary and cross-national panel database of micro data on health, socio-economic status and social and family networks...

Ngày tải lên: 28/03/2014, 16:20

94 517 0
báo cáo hóa học:" Research Article Evaluation and Design Space Exploration of a Time-Division Multiplexed NoC on FPGA for Image Analysis Applications" docx

báo cáo hóa học:" Research Article Evaluation and Design Space Exploration of a Time-Division Multiplexed NoC on FPGA for Image Analysis Applications" docx

... Image Analysis Algorithms Image analysis consists of extracting some relevant parameters from one or several images Image analysis examples are object segmentation, feature extraction, motion ... This architecture is designed for most of image analysis applications Characteristics from such applications are used to propose a parameterized and adaptable architecture for FPGA 2.1 Characteristics ... easier than with Design Compiler Conclusion and Perspectives The presented architecture is a parameterized architecture dedicated to image analysis applications on FPGA All flows and data are analyzed...

Ngày tải lên: 21/06/2014, 20:20

15 390 0
Báo cáo hóa học: "Research Article Microarchitecture of a MultiCore SoC for Data Analysis of a Lab-on-Chip Microarra" docx

Báo cáo hóa học: "Research Article Microarchitecture of a MultiCore SoC for Data Analysis of a Lab-on-Chip Microarra" docx

... subsystems for the sample preparation for the electronic hybridization detection and the data analysis The sample preparation subsystems in case of DNA analysis concerns DNA extraction, PCR, and hybridization ... array Standard deviation calculation for one muta6600 microseconds tion (μBlaze at 100 MHz) Standard deviation calculation for the entire array (μBlaze at 100 MHz, calculating 850 5600 milliseconds ... Standard deviation calculation for one muta0.36 microseconds tion (using a HW core-accelerator) Standard deviation calculation for the entire 3.06 milliseconds array (using a HW core-accelerator)...

Ngày tải lên: 21/06/2014, 22:20

11 614 0
Báo cáo hóa học: " Use of Time-Frequency Analysis and Neural Networks for Mode Identification in a Wireless Software-Defined Radio Approach" pptx

Báo cáo hóa học: " Use of Time-Frequency Analysis and Neural Networks for Mode Identification in a Wireless Software-Defined Radio Approach" pptx

... Classification Baseband reconfigurable processing (a) Received signal RF stage ADC TF Analysis Features extraction Classification Baseband reconfigurable processing Mode identification (b) Figure 1: A general ... SP tools that can be employed for analysis of nonstationary signals and in other different applications [19] In this case, TF allows one to use a compact and robust signal representation By using ... superposition In an SR scenario, some signals can be strongly nonstationary and Time-Frequency Analysis for Mode Identification Received signal Transduce 1781 Features extraction Preprocessing Classification...

Ngày tải lên: 23/06/2014, 01:20

13 456 0
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot

... ATPase, H+ transporting, lysosomal 34kDa, V1 subunit D ATP6V1DL ttttcactagctgaagccaagtt ATP6V1DR gcgctttattgacattttggat VIRvsLTNP CD8 2.0 2.8 BAG3 cagccagataaacagtgtggac BAG3R agaggcagctggagactgg ... to APAF and hence activates CASP9 leading to the caspase cascade resulting in apoptosis G2 arrest and DNA damage signaling could also activate BAX leading to mitochondria-mediated apoptosis On ... pathway were MAP2K3 (MEK3) located along the MAPK p38 cascade and NFKBIA associated with NFKB activation (Figure 6, Additional File 2), indicating the upregulation of p38 pathway In JNK MAPK and...

Ngày tải lên: 13/08/2014, 01:20

21 376 0
Báo cáo sinh học: " Genetic parameters for social effects on survival in cannibalistic layers: Combining survival analysis and a linear animal model" pdf

Báo cáo sinh học: " Genetic parameters for social effects on survival in cannibalistic layers: Combining survival analysis and a linear animal model" pdf

... parameters are given on the hazard rate scale, the probability that an animal has a failure at a given time t, whereas genetic parameters of LAM are on the observed scale for survival days The difference ... 8200AB Lelystad, The Netherlands Authors’ contributions EDE performed the data analysis and the cross validation, wrote and prepared the manuscript for submission VD helped with the data analysis ... of an approximate multitrait BLUP evaluation to combine production traits and functional traits into a total merit index 52nd Annual Meeting of the European Association for Animal Production;...

Ngày tải lên: 14/08/2014, 13:21

10 427 0
Báo cáo sinh học: "A Bayesian analysis of the effect of selection for growth rate on growth curves in rabbits" doc

Báo cáo sinh học: "A Bayesian analysis of the effect of selection for growth rate on growth curves in rabbits" doc

... Bayesian data analysis, Chapman and Hall, London, 1995 [12] Geweke J., Evaluating the accuracy of sampling-based approaches to the calculation of posterior moments (with discussion), in: Bernardo ... need of a control population However, we only had data in the last generation of selection, not in the other ones, and the lack of data in all the other generations makes this task particularly ... posterior mean was larger than three standard deviations from the standard normal distribution [6] An atypical growth pattern was declared when the Mahalanobis distance between the individual growth...

Ngày tải lên: 14/08/2014, 13:21

21 301 0
A study on the opportunities for and constraints on developing students’ oral skills at an upper-secondary school

A study on the opportunities for and constraints on developing students’ oral skills at an upper-secondary school

... incoming messages at the typical rate of native-speaker interactions 6 All of these factors combine to make speaking in a second or foreign language a formidable task for language learners Sharing ... Positions of speaking in language teaching programs, Difficulties in and constraints on learning to speak a foreign language, and Factors affecting students’ participation in speaking activities ... Language Classroom Oxford University Press 18 Krashen, S D (1983) The Natural Approach- Language Acquisition in the Classroom Penganon: Alemany Press 19 Lam, Tran Thai Nhat (2003) The Application...

Ngày tải lên: 07/11/2012, 14:44

44 844 0
The yield gap of global grain production-A spatial analysis

The yield gap of global grain production-A spatial analysis

... remains, however, challenging with limited data availability as a major obstacle For this reason we used non-urban population data as proxy for agricultural population and hence labor availability ... to lack of appropriate data Globally consistent and comparable fertilizer application data are only available at the national scale We obtained grain type specific fertilizer application rates ... information on harvested areas and actual yields of 175 crops in 2000 at a arc resolution and are based on a combination of national-, state-, and county-level census statistics as well as information...

Ngày tải lên: 16/12/2012, 15:22

11 792 0
A CFD analysis on the effect of ambient conditions on the hygro-thermal stresses distribution in a planar ambient airbreathing PEM fuel cell

A CFD analysis on the effect of ambient conditions on the hygro-thermal stresses distribution in a planar ambient airbreathing PEM fuel cell

... 0) and condensation ( m phase < 0) is assumed Where m phase is mass transfer: for evaporation & & & & ( m phase = mevap ) and for condensation ( m phase = mcond ) (kg/s) So that the mass balance ... the steady-state Navier-Stokes equations, i.e the continuity equation, the mass conservation equation for each phase yields the volume fraction (r ) and along with the momentum equations the ... hydration and avoidance of water flooding in the cathode catalyst layer and/or gas diffusion layer [2] Water management is related with air supply to the cathode and is one of the crucial factors in an...

Ngày tải lên: 05/09/2013, 14:58

16 728 0
Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

... Heyer AG (2010) Mathematical modelling of the central carbohydrate metabolism in Arabidopsis thaliana reveals a substantial regulatory influence of vacuolar invertase on whole plant carbon metabolism ... into account metabolic dynamics and interdependencies rather than simple steady-state concentrations We present a method based on dynamic modelling that allows for the quantification and visualization ... Solute accumulation and compartmentation during the cold acclimation of puma rye Plant Physiol 98, 108–113 Lundmark M, Cavaco AM, Trevanion S & Hurry V (2006) Carbon partitioning and export in transgenic...

Ngày tải lên: 14/02/2014, 22:20

13 708 0
a contrastive analysis on adverbial clauses in the two languages

a contrastive analysis on adverbial clauses in the two languages

... Adverbial clauses of condition and concession a Adverbial clause of condition state the condition that must be satisfied before the action or state of affairs in the main clause may be true For example: ... 4.5 Adverbial clauses of purpose 4.6 Adverbial clauses of condition and concession 4.7 Adverbial clauses of manner and comparison 4.8 Adverbial clauses of level and emphasis 4.1 Adverbial clauses ... circumstances, can be omitted from a universal conditionalconcessive clauses For example : What your opinions (are), we will stand by you 3.2.4 Clauses of reason(cause) An adverbial clause of reason...

Ngày tải lên: 18/02/2014, 22:49

40 1,6K 9
Tài liệu Báo cáo khoa học: "A study of Information Retrieval weighting schemes for sentiment analysis" doc

Tài liệu Báo cáo khoa học: "A study of Information Retrieval weighting schemes for sentiment analysis" doc

... Delta TFIDF: An Improved Feature Space for Sentiment Analysis In Proceedings of the Third AAAI Internatonal Conference on Weblogs and Social Media, San Jose, CA, May AAAI Press (poster paper) A ... kernel and default parameters All results are based on leave-one out cross validation accuracy The reason for this choice of cross-validation setting, instead of the most standard ten-fold, is that ... detection (Lin and He, 2009) The approach is straightforward, intuitive, computationally efficient, doesn’t require additional human effort and takes into consideration standardized and tested notions...

Ngày tải lên: 20/02/2014, 04:20

10 669 0
Toward Sustainability A Plan for Collaborative Research on Agriculture and Natural Resource Management potx

Toward Sustainability A Plan for Collaborative Research on Agriculture and Natural Resource Management potx

... Science and Technology for International Development Office of International Affairs National Research Council 2101 Constitution Avenue Washington, DC 20418 Additional copies are available for sale ... this publication as the authoritative version for attribution Toward Sustainability: A Plan for Collaborative Research on Agriculture and Natural Resource Management http://www.nap.edu/catalog/1822.html ... this publication as the authoritative version for attribution Toward Sustainability: A Plan for Collaborative Research on Agriculture and Natural Resource Management http://www.nap.edu/catalog/1822.html...

Ngày tải lên: 06/03/2014, 15:20

163 402 0
DEAP: A Database for Emotion Analysis using Physiological Signals ppt

DEAP: A Database for Emotion Analysis using Physiological Signals ppt

... dominance and familiarity For 22 participants, frontal face video was also recorded This paper aims at introducing this publicly available2 database The database contains all recorded signal data, frontal ... participants in publicly available databases for analysis of spontaneous emotions from http://www.eecs.qmul.ac.uk/mmv/datasets/deap/ TABLE Database content summary Online subjective annotation ... C ONCLUSION In this work, we have presented a database for the analysis of spontaneous emotions The database contains physiological signals of 32 participants (and frontal face video of 22 participants),...

Ngày tải lên: 07/03/2014, 14:20

15 1K 0
w