... Ma Xiaoxiao, Wang Xi, Nirmalya Bag, Sun Guangyu, Angela Koh, Huang Shuangru, Sibel Yavas, Andreas Karampatzakis, Shi Hua Teo, Shiying Lim, Patrick Kramer, Kaijie Herbert Fan, and Kumaravel Kandaswamy ... And special thanks to SPIM users Antonija, Adam, Angela, Xuewen, Andreas, and Kumar I would like to acknowledge nancial, academic and technical support from department of chemistry and center ... academic career, thanks a lot for your constant help and support To all my friends, Ajay, Anuradha, Debanjan, Jasmine, Kuldeep, Rahul, Subha, Veer Bhadur, Zubair and many more for their company...
Ngày tải lên: 09/09/2015, 11:19
... pick a pair of target and contact surfaces, then define the applicable interface properties Tools are available to visualize initial contact status and contact directions, and even to take corrective ... is a prerelease feature in Release 7.0 Material Nonlinearity in ANSYS Mechanical For engineering design and application, it is essential to understand and accurately characterize material behavior ... Stamping (ANSYS LS-DYNA) and springback analysis (ANSYS Mechanical) Figure Nonlinear collapse study of a beverage can Common Features ANSYS Mechanical data input can be parametric, allowing for parametric...
Ngày tải lên: 23/12/2013, 01:16
Tài liệu ALLOCATION TO REPRODUCTION IN A HAWKMOTH: A QUANTITATIVE ANALYSIS USING STABLE CARBON ISOTOPES docx
... hawkmoth nectars (Baker and Baker 1983), and is commercially available as either beet sugar or cane sugar (C3 and C4 plants, respectively) We trace the allocation of these dietary sugars into ... conversion factor was calculated from the amino acid composition of A floridensis eggs, measured as mole percentage (Beckman 6300 Amino Acid Analyzer, Fullerton, California, USA) and converted to mass ... subtropical rangeland offers predominantly C plants for grazing cattle, milk casein was enriched in 13 C relative to C3 plants Amino acids were added to the C3 and C4 sugar diets to a final concentration...
Ngày tải lên: 13/02/2014, 16:20
Tài liệu Báo cáo khoa học: "Identifying Linguistic Structure in a Quantitative Analysis of Dialect Pronunciation" docx
... dialectometry Aggregate Analysis In the first phase of this project L04 toolkit was used in order to make an aggregate analysis of Bulgarian dialects In this section more information on the data ... Stojkov 1966 Atlas of Bulgarian Dialects: Northeastern Bulgaria Publishing House of Bulgarian Academy of Science, volume II, So a, Bulgaria Stojko Stojkov 2002 Bulgarska dialektologiya So a, 4th ed ... (Manning and Schütze, 1999) Multidimensional scaling is data analysis technique that provides a spatial display of the data revealing relationships between the instances in the data set (Davison,...
Ngày tải lên: 20/02/2014, 12:20
Tài liệu Báo cáo khoa học: "a Computer-Aided Summarisation Tool" docx
... is to investigate to what extent an automatic summarisation system can help a human summariser produce high quality summaries A tool which integrates several well-known summarisation methods and ... option to override the program's decisions and extract additional sentences In addition to being used as a computeraided summarisation tool, CAST can be used as an annotation tool In this case, ... 1) I cA lAio±TAI L? •rt Oval:Aiwa!' ihe prolzde m ms•lances and 'problem classes The resuhs On plateau characteristics allowed us to rarrharprel The SUCEIM (Ir rramirrldlarrIC7110r5 Ilo searchi...
Ngày tải lên: 22/02/2014, 02:20
Báo cáo khoa học: "a bilingual dictionary generating tool" potx
... human or a machine, expects all translations to be accurate We evaluated 2000 randomly selected Japanese entries from the initial translation candidates, scoring all Hungarian translations as correct ... several POS (noun, verb, adjective and adverb for synonymy and antonymy relations; noun and verb for semantic category) based scores, multiplied by a multiplication factor (mfactor) This factor varies ... source-pivot and target-pivot dictionaries, comparing pivot language translations There are six types of translations that we label A- F and explain below as follows First, we select translation candidates...
Ngày tải lên: 08/03/2014, 01:20
Bell & Howell Information and Learning 300 North Zeeb Road, Ann Arbor, MI 48106-1346 USA 800-521-0600UMI.The Potential of Soil Survey Data in a Quantitative Evaluation of Surficial Geology Mapping in Northern Maine by Rosalia EvansThesis submitted t pptx
... stony loam Machias gravelly loam Machias gravelly loam Machias gravelly loam Madawaska fine sandy loam Madawaska fine sandy loam Madawaska fine sandy loam Made land Mapleton shaly silt loam Mapleton ... Howland Caribou Mondara Burnham Easton Washburn Conant Daigle Thorndike Mapleton Stetson Canandaigua Salmon Nicholville Allagash Red Hook Atherton Machias Madawaska Fredon Halsey Mixed Alluvial ... EaA EaB EsB FhA FhB HaA HaB HoA HoB HoC HvB HvC MaA MaB MaC MbA MbB MbC Md MhB MhC MhD Mn MoA MoB MrB Allagash Allagash Allagash Allagash Canadaigua silt loam, thin solum Caribou Caribou Caribou...
Ngày tải lên: 08/03/2014, 23:20
Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx
... evaluation, common in the machine translation domain and already used for paraphrase evaluation (Bannard and Callison-Burch, 2005) The question asked to the human evaluator for the syntactic task ... state-of-the-art to generate paraphrases Colin Bannard and Chris Callison-Burch 2005 Paraphrasing with bilingual parallel corpora In Annual Meeting of ACL, pages 597–604, Morristown, NJ, USA Association ... because a statistical paraphrase table, an analogical solver and a paraphrase memory for instance; there is no constraint on the scoring function because it only scores final states Note that...
Ngày tải lên: 17/03/2014, 02:20
Đề tài " A quantitative version of the idempotent theorem in harmonic analysis " docx
... modulo a prime, Canadian J Math., to appear [11] B J Green and I Z Ruzsa, An analogue of Freiman’s theorem in an arbitrary abelian group, J London Math Soc 75 (2007), 163–175 1054 BEN GREEN AND TOM ... (γ(ai ) + γ(ai ))) It is easy to check that p enjoys the standard properties of Riesz products, namely that p is real and nonnegative and that p A = γ p(γ) = 1, and that Supp(p) ⊆ a1 , , am ... there are at least δ |A| 3 additive quadruples (a1 , a2 , a3 , a4 ) in A4 with a1 + a2 = a3 + a4 Then there is a regular Bourgain system S satisfying dim(S) Cδ −C ; |S| e−Cδ −C |A| and ψS 1A ∞ cδ...
Ngày tải lên: 22/03/2014, 20:21
Báo cáo khoa học: "Multilingual adaptations of ANNIE, a reusable information extraction tool" doc
... from ANNIE in a similar way to the Bulgarian one, using a tokeniser, gazetteer and a JAPE semantic grammar Figure shows some Romanian text annotated in GATE Romanian is a more flexible language ... easily customised for new languages (Pastra et al., 2002) So far, ANNIE has been adapted to IE in Bulgarian, Romanian, Bengali, Greek, Spanish, Swedish, German, Italian, and French, and we are currently ... end-used applications can be used to bootstrap the creation of IE-annotated corpora and/ or facilitate the training of learning tools for adaptive IE In addition, some adaptive IE tools are now...
Ngày tải lên: 24/03/2014, 03:20
Antibody response to influenza vaccination in the elderly: A quantitative review doc
... studies and generated and analyzed summary values for age and adjustment factors for each sub-study This may have led to some loss of precision, although the potential for misclassification bias seems ... seroprotected before vaccination, although these differences were not always statistically significant In univariate analysis, age had a significant impact on the response to vaccination as measured by seroconversion, ... with a mean age above or below 75, as a best proxy for age In univariate and multivariate analysis, there was a significantly lower response in those over 75 years of age, suggesting that Ab response...
Ngày tải lên: 28/03/2014, 20:20
eDiscovery Project Management: Guidance On Developing A Methodology And Documentary Tools docx
... Obtain an inventory of presently available Active Media (e.g., servers and desktops in use) and Passive Media (e.g., backups such as tapes and DVDs) Create additional backups of Active Media as ... a case management protocol), vacated and remanded in part, 2008 WL 638108 (S.D Cal Mar 8, 2008) -4- eDiscovery Project Management: Guidance On Developing A Methodology And Documentary Tools and ... (e.g., servers and laptops) and passive media (e.g., tapes and DVDs), including any changes over time (e.g., dates in service and of any reformatting and redeployment) Obtain interviews and/ or documents...
Ngày tải lên: 29/03/2014, 23:20
Báo cáo khoa học: The heat shock protein 70 molecular chaperone network in the pancreatic endoplasmic reticulum ) a quantitative approach potx
... Chem 279, 11432–11443 Eki T, Naitou M, Hagiwara H, Ozawa M, Sasanuma SI, Sasanuma M, Tsuchiya Y, Shibata T, Hanaoka F & Murakami Y (1996) Analysis of a 36.2 kb DNA sequence including the right ... presence of ATP (D) Subsequently, unbound (lanes and 2) and bound (lanes and 4) material were separated by centrifugation, and analyzed by SDS ⁄ PAGE and protein staining with Coomassie Brilliant Blue ... in contrast to BiP, Grp170 appears to be unable to form a stable complex with Hsp40-type proteins Grp170 has a low basal ATPase activity that was hardly stimulated by ERj1J and serves as a nucleotide...
Ngày tải lên: 30/03/2014, 03:20
Báo cáo khoa học: Protein transport into canine pancreatic microsomes A quantitative approach potx
... SRP-dependent manner and cotranslationally, yeast prepro -a- factor (Fig 2D, bars and vs and 2), and a precursor that is transported predominantly in an SRPdependent manner and cotranslationally when ... microsomes, a preprocecropin– dihydrofolate reductase hybrid (Fig 2E, bars and vs and 2) [29] We note that yeast prepro -a- factor is transported into mammalian microsomes only cotranslationally and that ... pancreas Thus, we calculate that 12 · 1015 molecules of cotranslationally active protein translocases are present per canine pancreas, or about twice that number for a typical human pancreas An...
Ngày tải lên: 30/03/2014, 15:20
Báo cáo khoa học: "A Quantitative Analysis of Lexical Differences Between Genders in Telephone Conversations" pot
... Stamatatos, N Fakotakis, and G Kokkinakis 2000 Automatic text categorization in terms of genre and author Computational Linguistics, 26:471–495 A Stolcke 2002 An extensible language modeling toolkit ... each Each person participates in 1-3 conversations, and each conversation is annotated with a topicality label The topicality label gives the degree to which the suggested topic was followed and ... grandkids, son, grandson, daughter, granddaughter, boyfriend, marriage, mother, grandmother It is also interesting to note that a number of nonlexical tokens are strongly associated with a certain gender...
Ngày tải lên: 31/03/2014, 03:20
Báo cáo khoa học: "A Quantitative Evaluation of Linguistic Tests for the Automatic Prediction of Semantic Markedness" potx
... extracts the relevant data for these tests from text corpora and corpora-based databases, and use this system to measure the applicability and accuracy of each method We apply statistical tests to ... productivity operates with high recall and precision; and (4) the mapping of the linguistic tests to comparisons of quantitative variables was in most cases straightforward, and always at least plausible ... Fall Symposium AAAI T Hastie and D Pregibon 1990 Shrinking trees Technical report, AT&T Bell Laboratories Vasileios Hatzivassiloglou and Kathleen McKeown 1993 Towards the automatic identification...
Ngày tải lên: 31/03/2014, 06:20
báo cáo hóa học:" CRP identifies homeostatic immune oscillations in cancer patients: a potential treatment targeting tool?" pdf
... colorectal adenoma and cancer patients Clin Chem Lab Med 2008, 46(10):1423-8 Sawamura M, Yamaguchi S, Murakami H, Kitahara T, Itoh K, Maehara T, Kawada E, Matsushima T, Tamura J, Naruse T: Cyclic haemopoiesis ... days apart, and repeated) over time, in late-stage advanced cancer Days Days Days Figure CRP cycle in a patient with advanced melanoma CRP cycle in a patient with advanced melanoma Representative ... have examined L-CRP in the serum of patients with advanced melanoma and ovarian cancer, measured serially 1-2 days apart, and identified an apparent 'cycle' in the CRP levels Serial L-CRP measurements...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc
... cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaa SElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaac Seo et al ... 3’) SEA SED M18970 M28521 cttgtacatatgagcgagaaaagcgaagaa cgttctcgagaatgaaaacattgattc gcgcggatccttaacttgtatataaata cgcgctcgagctacttttcatataaata SEE M21319 ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaata ... gcgcggatcctcaagttgtgtataaata SEG AF064773 tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaaga SEI AF285760 tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacata SElM AF285760 cgcacatatggatgtcggagttttgaat...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: " cDNA targets improve whole blood gene expression profiling and enhance detection of pharmocodynamic biomarkers: a quantitative platform analysis" ppt
... study, participated in the analysis of the SAHA data and participated in the drafting and editing of the manuscript All authors read and approved the final manuscript Competing interests All authors ... processing and analysis Microarray data quality was assessed using standard metrics [26] RMA was used for data normalization and processing [27] Analysis was done using log scale intensity values Genes ... support AL and MN completed the analysis of the SAHA data MM assisted with the data analysis and participated in drafting and editing of the manuscript SL completed the analysis of the protocol...
Ngày tải lên: 18/06/2014, 16:20
báo cáo sinh học:" Meeting human resources for health staffing goals by 2018: a quantitative analysis of policy options in Zambia" potx
... operating with fewer than half the health workforce necessary to deliver basic health services, with even higher vacancy rates in rural areas [18] Staff -to- population ratios nationally are as ... Foundation assessment of all 39 medical training institutions in Zambia The assessment determined graduation rates to be 9097%, based on available data and interviews with school staff [27] The same assessment ... currently a surplus of qualified applicants at the national training institutions, this may change if training institution enrolment were increased dramatically Adequate preparation in primary and...
Ngày tải lên: 18/06/2014, 17:20