... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products ... rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a...
Ngày tải lên: 19/02/2014, 17:20
... Netherlands A. Y Hoekstra and A. K Chapagain – July 2006 22 Water’s vulnerable value in Africa P van der Zaag – July 2006 23 Human appropriation of natural capital: Comparing ecological footprint and water ... Seyam and A. Y Hoekstra − December 2000 The value of irrigation water in Nyanyadzi smallholder irrigation scheme, Zimbabwe G.T Pazvakawambwa and P van der Zaag – January 2001 The economic valuation ... business water footprint accounting can be done at any level of aggregation – provided that data on inputs are available – but that accounting at a lower level of aggregation provides data at a lower...
Ngày tải lên: 06/03/2014, 21:20
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
... Table 7. Standardized score for costs of combinations Measure A1 +A2 .3 A1 +B1 A1 +B2 A1 +B1+B2 A2 .1 +A2 .3 A2 .1+B1 A2 .2 +A2 .3 A2 .2+B1 A2 .3+B1 A2 .3+B1+B2 Standardized cost Standardized score ... doing so, the consensus on the problems and their solutions can be reached. However, it is noted that MCA is subjective in its nature. In case the quantitative data are available, quantitative analysis (i.e. numerical ... own advantages and disadvantages. Table 1 summarizes some these methods and their features. In comparison with the ranking and rating methods, pairwise comparison and trade‐off ...
Ngày tải lên: 22/03/2014, 12:20
the community development handbook a tool to build community capacity
... support was greatly appreciated It was presented in a way that was understood and realistic because it was based on experience with what works and what doesn't It was also validated and highly valued ... that it is familiar to us and that we have a part to play in it This handbook has been created by the Labor Market Learning and Development Unit at Human Resources Development Canada to support ... undertaken As a small group, informal communication and organizational arrangements were probably all that s s s s s d e v e l o p i n g s integrating and coordinating a variety of tasks and activities,...
Ngày tải lên: 27/05/2014, 07:47
báo cáo sinh học:" Developing a tool to measure health worker motivation in district hospitals in Kenya" pot
... current work was, however, to develop a rapid tool (eventually of 10 items) that, through factor analysis, appears to capture motivation quantitatively Qualitative data suggest that the questions ... representing three latent factors, that appeared suitable for use as a rapid tool for quantitative assessments of motivation Qualitative data and reflection on observations made by the PI in this ... developed an SAQ to assess motivation in hospital-based Kenyan health workers Additionally, a comparison of the quantitative and qualitative results was made to help understand the motivation score...
Ngày tải lên: 18/06/2014, 17:20
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot
... equally to the variance of the total score, and can be summed without weighting Item-total scale correlations for all scales were satisfactory implying that the items in each scale contain a similar ... (the aim was to achieve a simple structure, that is, each item should be associated with one and only one factor) Data quality Missing item data < 10% High % computable scale scores Scaling assumptions ... to this an explicit and valid outcome measure to quantify patients’ experiences of relapse management is needed as the primary outcome Although patient “satisfaction” ratings are often used as...
Ngày tải lên: 20/06/2014, 15:20
báo cáo hóa học:" Development of the ATAQ-IPF: a tool to assess quality of life in IPF" doc
... domains and in aggregate) to Rasch analysis The retained items–by virtue of fitting the Rasch model, like all items that fit the Rasch model–are guaranteed to have the same measurement characteristics ... Denver, Colorado, 80206, USA 2Palo Alto Medical Foundation Research Institute, Palo Alto Medical Foundation, 795 El Camino Real, Palo Alto, California, 94301, USA 3Morgridge College of Education, University ... and had greater impairments in emotional well-being, social participation, sexual health, relationships, and overall HRQL (according to the ATAQ-IPF total) than subjects not using supplemental...
Ngày tải lên: 20/06/2014, 16:20
Báo cáo hóa học: " Research Article SPRINT: A Tool to Generate Concurrent Transaction-Level Models from Sequential Code" potx
... at references to A In the current implementation, a base variables must be a scalar, an array of scalars, a pointer to a scalar, or a pointer to an array of scalars, where a scalar is a variable ... pointer base variables are all scalar and array of scalar variables Heap locations are not analyzed; if a base variable can refer to a heap location, a report is generated the designer, who can take ... Note that pointers automatically arise in C when an array is passed as a parameter to a function: C automatically converts the array parameter to a pointer parameter This is a common situation...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo y học: "Genome Alteration Print (GAP): a tool to visualize and mine complex cancer genomic profiles obtained by SNP arrays" docx
... ratio 0.0 AAAB Log R ratio 0.0 AABBB AAABB ABBB AABB ABB AAAB AAA ABBB BBB ABB AAB BB AB BB AB A B -1.0 -1.0 AA AABB AA -0.5 -0.5 AAB 0.0 (a) Popova et al R128.7 0.2 0.4 0.6 0.8 1.0 B Allele frequency ... (a) 0.2 0.4 0.6 0.8 B Allele frequency 1.0 1.0 0.0 (b) BB B 0.2 0.4 0.6 0.8 B Allele frequency AA AB BB -1.0 A AAAB AABB ABBB ABB BBB AAA AAB -0.5 AB Log R ratio 0.0 0.5 1.0 AA AABB ABBB BBB AAB ... AABB ABBB BBB AAB ABB AAAB -1.0 B Log R ratio 0.0 0.5 BB -1.0 A AB AAA -0.5 -0.5 AA ABB Popova et al R128.5 of a haploid genome, possibly similar to the triploid glioblastoma cases described...
Ngày tải lên: 09/08/2014, 20:20
Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt
... diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning when teaching medical students and ... Journal of Obstetrics and Gynaecology, which has substantiated information about ovarian cancers and amenorrhea [8] In this way, continually organizing and updating information on an Ishikawa diagram ... relevant case reports and literatures are also indicated in the Ishikawa diagram so that readers can retrieve the case reports and relevant literatures easily The potential causes for secondary amenorrhea/oligomenorrhea...
Ngày tải lên: 11/08/2014, 00:23
Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc
... Implementation Science 2009, 4:46 knowledge; and to facilitate organizational change [19] Thus, an organization that supports and encourages innovation, data collection and analysis, and critical appraisal ... people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and subscriptions The Page of (page number ... distinctions that the tool makes in relation to these four areas are important to identify The tool can serve as a catalyst for an important discussion about research use; such a discussion, in and of...
Ngày tải lên: 11/08/2014, 05:21
báo cáo khoa học: " Peer chart audits: A tool to meet Accreditation Council on Graduate Medical Education (ACGME) competency in practicebased learning and improvement" docx
... date have evaluated self-audits or external audits, and most combined chart audit with formal feedback or an educational intervention [8-11] Audit-feedback generally involves external audit and ... patients, and patient lists were reviewed manually to ascertain that no patient's chart was used more than once per audit Audit one was performed in June 2003 Residents were allowed to abstract ... require additional personnel, careful planning, and expertise in data management These additional resources will have financial implications for residency program directors and department heads Our...
Ngày tải lên: 11/08/2014, 05:22
báo cáo khoa học: " Is research working for you? validating a tool to examine the capacity of health organizations to use research" pdf
... Implementation Science 2009, 4:46 knowledge; and to facilitate organizational change [19] Thus, an organization that supports and encourages innovation, data collection and analysis, and critical appraisal ... people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and subscriptions The Page of (page number ... distinctions that the tool makes in relation to these four areas are important to identify The tool can serve as a catalyst for an important discussion about research use; such a discussion, in and of...
Ngày tải lên: 11/08/2014, 16:20
Báo cáo khoa học: "Hyperglycaemic index as a tool to assess glucose control: a retrospective study" docx
... mean age was 55 years (standard deviation 19 years) and 65% were male Table lists the demographical data and glucose-related measures for survivors and nonsurvivors APACHE II scores were available ... that possess a patient database management system that can provide automated input for the HGI calculation The fact that HGI expresses glucose regulation as a single value has methodological advantages ... were obtained from the central laboratory database Therapeutic protocol Patients were fed enterally as soon as possible Total parenteral nutrition was only given when enteral nutrition failed Concentrated...
Ngày tải lên: 12/08/2014, 20:20
Báo cáo y học: " Factor correction as a tool to eliminate between-session variation in replicate experiments: application to molecular biology and retrovirology" ppsx
... Figure A: original data B: normalised data C: standardised data D: data after factor correction Note that normalisation, standardisation, and factor correction reduce the variation within each condition ... rection Comparison of normalisation, standardisation and factor corComparison of normalisation, standardisation and factor correction Mean (and SEM) of the data of the molecular-biology data set from ... approach assigns part of the variation to the estimated session factors The ratio approach can be seen as a special case, in which the user assumes that the multiplicative factor is the same for...
Ngày tải lên: 13/08/2014, 09:21
Báo cáo y học: "So much to teach, so little time: a prospective cohort study evaluating a tool to select content for a critical care curriculum" potx
... study, participated in data collection and statistical analysis, and drafted the manuscript KM helped to develop the study design, participated in statistical analysis and helped to draft the manuscript ... the procedure was repeated by adding them together to create a separate composite score that could range from to For each of the clinical presentations, we calculated a mean value for the two ... identified residents and critical care medicine attending physicians as our key stakeholders For each of the presentations we asked participants to assign a numerical value from to based on the descriptions...
Ngày tải lên: 13/08/2014, 11:23
Tài liệu Báo cáo khoa học: "Using Automatically Transcribed Dialogs to Learn User Models in a Spoken Dialog System" doc
... future applications, such as continuous learning of a user model while the dialog system is on-line, enabling automatic adaptation References −5 Truth Manual EM Automatic −6 −7 −8 Manual EM Automatic ... estimate using automatically transcribed data, i.e., θasu = e KD P as D e a Kas This approach ignores transcription errors and assumes that user behavior depends only on the observed data EM: ... enough dialogs, the EM method is able to leverage the hidden user state to learn a better model of user behavior, with an average normalized log-likelihood that falls about halfway between that of...
Ngày tải lên: 20/02/2014, 09:20
Tài liệu User-Centered Design: A Developer''''s Guide to Building User-Friendly Applications ppt
... In an article published in interactions magazine, Arnold Lund makes a similar case: An alternative approach is to view usability testing as part of a software quality manage‐ ment program and to ... world.” —Lauren Bacall On January 9, 2007, a man quietly walked onto a stage and changed the course of tech‐ nological history He announced that his company was about to launch a product that would ... at the hospital all the time As much as I might wish I was a doctor, even after all these years, I still don’t have enough terminology to star as an extra in Grey’s Anatomy Every day, I’m learning...
Ngày tải lên: 21/02/2014, 10:20
Tài liệu Báo cáo khoa học: "SWAN – Scientific Writing AssistaNt A Tool for Helping Scholars to Write Reader-Friendly Manuscripts " docx
... although evidence remains anecdotal At this early stage, SWAN’s capabilities are narrow in scope.We continue to enhance the existing evaluation metrics And we are eager to include a new and already ... metrics, automatic and manual ones Automatic metrics are solely implemented as text analysis of the original document using NLP tools An example would be locating judgemental word patterns such as suffers ... [Dale and Kilgarriff2010] R Dale and A Kilgarriff 2010 Text massaging for computational linguistics as a new shared task In Proc 6th Int Natural Language Generation Conference, Dublin, Ireland...
Ngày tải lên: 22/02/2014, 03:20