a tool to aid decision making

Business strategy a guide to effective decision making pot

Business strategy a guide to effective decision making pot

... scientific-management approach to production department work; and Peter Drucker can be categorised as a classical administrator, at least in his approach to strategy development and decision- making ... leaders and organisations work Decision- making had been flawed and was incapable of understanding what actually happens in organisations, leaving them poorly placed to face the challenge of change ... remains to be learnt about what it can and, in particular, how to use it As Marchand says: Information can be used to develop and sustain competitive advantage, it is the way people in organisations...

Ngày tải lên: 28/06/2014, 22:20

253 381 1
business strategy a guide to effective decision making phần 1 pptx

business strategy a guide to effective decision making phần 1 pptx

... SOCIAL, CULTURAL AND COMMERCIAL FORCES era of mass customisation has therefore overcome many contradictory difficulties This increasing rate of change, so far as leadership and decisionmaking are ... PM Page SOCIAL, CULTURAL AND COMMERCIAL FORCES Asia, Latin America and central Europe were ready sources of cheap labour and potentially profitable new markets However, globalisation has made ... splinter organisations Consider the range and depth of skills and knowledge needed to manage a chain of retail stores, a hospital, a university, an automotive manufacturer or a financial services...

Ngày tải lên: 10/08/2014, 07:20

26 385 0
business strategy a guide to effective decision making phần 2 potx

business strategy a guide to effective decision making phần 2 potx

... scientific-management approach to production department work; and Peter Drucker can be categorised as a classical administrator, at least in his approach to strategy development and decision- making ... leaders and organisations work Decision- making had been flawed and was incapable of understanding what actually happens in organisations, leaving them poorly placed to face the challenge of change ... remains to be learnt about what it can and, in particular, how to use it As Marchand says: Information can be used to develop and sustain competitive advantage, it is the way people in organisations...

Ngày tải lên: 10/08/2014, 07:20

25 294 0
business strategy a guide to effective decision making phần 3 docx

business strategy a guide to effective decision making phần 3 docx

... The inability to understand change and adapt to it is characterised by organisational inertia Many organisations falter because they fail to recognise that the market has changed, with increased ... together and were encouraged to think for themselves This had a dramatic impact on profits Reduce bureaucracy and streamline decision- making Bureaucracy can paralyse Exacerbated by top-down management, ... perceptions of an organisation or brand are all factors that are directly affected by the management and use of information technology Information and its analysis are crucial to corporate survival and...

Ngày tải lên: 10/08/2014, 07:20

25 399 0
business strategy a guide to effective decision making phần 4 potx

business strategy a guide to effective decision making phần 4 potx

... into left-brain activities, those that are logical and analytical, and right-brain activities, those that are creative and integrative A systematic approach to creativity is provided by Edward ... Personal involvement is a chance to motivate and encourage, as well as an opportunity to see where adjustments will or may be necessary as circumstances change A technique that can help to manage ... business areas such as marketing, public relations and communication, managing people and researching Areas such as planning, process management and finance are harder business functions that benefit...

Ngày tải lên: 10/08/2014, 07:20

25 297 0
business strategy a guide to effective decision making phần 6 pot

business strategy a guide to effective decision making phần 6 pot

... dealing with customers They are also a valuable source of information Analysing information Database vendors provide tools that allow analysis of information contained in a database, using a ... Thousands contacted the organisation’s headquarters in Atlanta Remarkably, many were not Coca-Cola drinkers, simply American consumers disappointed at a major change to an iconic American product ... redefining and focusing on core operations The main advantages are a clear focus and strength in depth, with all available resources channelled into one endeavour It also means that any cash available...

Ngày tải lên: 10/08/2014, 07:20

25 379 0
business strategy a guide to effective decision making phần 10 doc

business strategy a guide to effective decision making phần 10 doc

... mental attitude is an important source of strength and advantage Behaviours to avoid in decision- making include procrastination or panic Instead, adopting a calm, positive and appropriate approach ... international expansion 96 regulation 26 average cost pricing 188 Page 235 awareness raising 60 B balanced scorecard 11, 42–5 Banco Bilbao Vizcaya Argentaria (BBVA) 159 Bank of America 149 Barbour, ... United States by Harvard Business School Press as The Age of Paradox) Semler, R., Maverick!, Arrow, 1994 Kaplan, R and Norton, D., The Balanced Scorecard: Translating Strategy into Action, Harvard...

Ngày tải lên: 10/08/2014, 07:20

27 313 0
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk (5Â-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3Â) (N A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG ... AAGGATCCTTGTGTTTTTCTCCTATAATG-3¢) and downstream to pyk using primer pyk3 (5¢-GGAAGGA TCCTTTGTCAATTAATGATCTTAAAAC-3¢) and pyk4 (5¢-CTAGTCTAGATGAGCTCCAGAAGCTTCC-3¢) were amplified The PCR products ... rate to CPK % Product formation changed significantly as the PK activity was modulated At increased PK activity we found an almost proportional increase in formate and acetate production and a...

Ngày tải lên: 19/02/2014, 17:20

12 616 0
Business water footprint accounting: A tool to assess how production of goods and services impacts on freshwater resources worldwide pdf

Business water footprint accounting: A tool to assess how production of goods and services impacts on freshwater resources worldwide pdf

... Netherlands A. Y Hoekstra and A. K Chapagain – July 2006 22 Water’s vulnerable value in Africa P van der Zaag – July 2006 23 Human appropriation of natural capital: Comparing ecological footprint and water ... Seyam and A. Y Hoekstra − December 2000 The value of irrigation water in Nyanyadzi smallholder irrigation scheme, Zimbabwe G.T Pazvakawambwa and P van der Zaag – January 2001 The economic valuation ... business water footprint accounting can be done at any level of aggregation – provided that data on inputs are available – but that accounting at a lower level of aggregation provides data at a lower...

Ngày tải lên: 06/03/2014, 21:20

46 960 0
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc

... Table 7. Standardized score for costs of combinations  Measure  A1 +A2 .3  A1 +B1  A1 +B2  A1 +B1+B2  A2 .1 +A2 .3  A2 .1+B1  A2 .2 +A2 .3  A2 .2+B1  A2 .3+B1  A2 .3+B1+B2  Standardized cost  Standardized score ... participation,  which  are all needed in the decision making process  [7].  MCA  is  a qualitative  analysis  method  which  allows  the  use  of  participatory  approach  in  the  decision making ... doing so, the consensus on the problems and  their solutions can be reached. However, it is  noted that MCA is subjective in its nature. In  case  the  quantitative  data  are  available,  quantitative  analysis  (i.e.  numerical ...

Ngày tải lên: 22/03/2014, 12:20

13 488 0
the community development handbook a tool to build community capacity

the community development handbook a tool to build community capacity

... support was greatly appreciated It was presented in a way that was understood and realistic because it was based on experience with what works and what doesn't It was also validated and highly valued ... that it is familiar to us and that we have a part to play in it This handbook has been created by the Labor Market Learning and Development Unit at Human Resources Development Canada to support ... undertaken As a small group, informal communication and organizational arrangements were probably all that s s s s s d e v e l o p i n g s integrating and coordinating a variety of tasks and activities,...

Ngày tải lên: 27/05/2014, 07:47

90 284 0
báo cáo sinh học:" Developing a tool to measure health worker motivation in district hospitals in Kenya" pot

báo cáo sinh học:" Developing a tool to measure health worker motivation in district hospitals in Kenya" pot

... current work was, however, to develop a rapid tool (eventually of 10 items) that, through factor analysis, appears to capture motivation quantitatively Qualitative data suggest that the questions ... representing three latent factors, that appeared suitable for use as a rapid tool for quantitative assessments of motivation Qualitative data and reflection on observations made by the PI in this ... developed an SAQ to assess motivation in hospital-based Kenyan health workers Additionally, a comparison of the quantitative and qualitative results was made to help understand the motivation score...

Ngày tải lên: 18/06/2014, 17:20

11 446 0
báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot

báo cáo hóa học: " A tool to measure the attributes of receiving IV therapy in a home versus hospital setting: the Multiple Sclerosis Relapse Management Scale (MSRMS)" pot

... equally to the variance of the total score, and can be summed without weighting Item-total scale correlations for all scales were satisfactory implying that the items in each scale contain a similar ... (the aim was to achieve a simple structure, that is, each item should be associated with one and only one factor) Data quality Missing item data < 10% High % computable scale scores Scaling assumptions ... to this an explicit and valid outcome measure to quantify patients’ experiences of relapse management is needed as the primary outcome Although patient “satisfaction” ratings are often used as...

Ngày tải lên: 20/06/2014, 15:20

8 493 0
báo cáo hóa học:" Development of the ATAQ-IPF: a tool to assess quality of life in IPF" doc

báo cáo hóa học:" Development of the ATAQ-IPF: a tool to assess quality of life in IPF" doc

... domains and in aggregate) to Rasch analysis The retained items–by virtue of fitting the Rasch model, like all items that fit the Rasch model–are guaranteed to have the same measurement characteristics ... Denver, Colorado, 80206, USA 2Palo Alto Medical Foundation Research Institute, Palo Alto Medical Foundation, 795 El Camino Real, Palo Alto, California, 94301, USA 3Morgridge College of Education, University ... and had greater impairments in emotional well-being, social participation, sexual health, relationships, and overall HRQL (according to the ATAQ-IPF total) than subjects not using supplemental...

Ngày tải lên: 20/06/2014, 16:20

9 719 0
Báo cáo hóa học: " Research Article SPRINT: A Tool to Generate Concurrent Transaction-Level Models from Sequential Code" potx

Báo cáo hóa học: " Research Article SPRINT: A Tool to Generate Concurrent Transaction-Level Models from Sequential Code" potx

... at references to A In the current implementation, a base variables must be a scalar, an array of scalars, a pointer to a scalar, or a pointer to an array of scalars, where a scalar is a variable ... pointer base variables are all scalar and array of scalar variables Heap locations are not analyzed; if a base variable can refer to a heap location, a report is generated the designer, who can take ... Note that pointers automatically arise in C when an array is passed as a parameter to a function: C automatically converts the array parameter to a pointer parameter This is a common situation...

Ngày tải lên: 22/06/2014, 19:20

15 294 0
Báo cáo y học: "Genome Alteration Print (GAP): a tool to visualize and mine complex cancer genomic profiles obtained by SNP arrays" docx

Báo cáo y học: "Genome Alteration Print (GAP): a tool to visualize and mine complex cancer genomic profiles obtained by SNP arrays" docx

... ratio 0.0 AAAB Log R ratio 0.0 AABBB AAABB ABBB AABB ABB AAAB AAA ABBB BBB ABB AAB BB AB BB AB A B -1.0 -1.0 AA AABB AA -0.5 -0.5 AAB 0.0 (a) Popova et al R128.7 0.2 0.4 0.6 0.8 1.0 B Allele frequency ... (a) 0.2 0.4 0.6 0.8 B Allele frequency 1.0 1.0 0.0 (b) BB B 0.2 0.4 0.6 0.8 B Allele frequency AA AB BB -1.0 A AAAB AABB ABBB ABB BBB AAA AAB -0.5 AB Log R ratio 0.0 0.5 1.0 AA AABB ABBB BBB AAB ... AABB ABBB BBB AAB ABB AAAB -1.0 B Log R ratio 0.0 0.5 BB -1.0 A AB AAA -0.5 -0.5 AA ABB Popova et al R128.5 of a haploid genome, possibly similar to the triploid glioblastoma cases described...

Ngày tải lên: 09/08/2014, 20:20

14 256 0
Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt

Báo cáo y học: " Using an Ishikawa diagram as a tool to assist memory and retrieval of relevant medical cases from the medical literature" ppt

... diagram can cultivate lifelong learning habits in medical professionals Medical educators can also apply Ishikawa diagrams to facilitate problem-based learning when teaching medical students and ... Journal of Obstetrics and Gynaecology, which has substantiated information about ovarian cancers and amenorrhea [8] In this way, continually organizing and updating information on an Ishikawa diagram ... relevant case reports and literatures are also indicated in the Ishikawa diagram so that readers can retrieve the case reports and relevant literatures easily The potential causes for secondary amenorrhea/oligomenorrhea...

Ngày tải lên: 11/08/2014, 00:23

3 381 0
Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc

Báo cáo y học: "Is research working for you? validating a tool to examine the capacity of health organizations to use research" doc

... managers, and politicians – make decisions that are every bit as critical as those of the practitioner Senior health system administrators and managers make decisions ranging from day -to- day ... Implementation Science 2009, 4:46 knowledge; and to facilitate organizational change [19] Thus, an organization that supports and encourages innovation, data collection and analysis, and critical appraisal ... people in an organization who were available to access research Furthermore, there was an awareness of the research being available via internal databases and subscriptions The Page of (page number...

Ngày tải lên: 11/08/2014, 05:21

9 506 0
Báo cáo y học: " A method for studying decision-making by guideline development groups" potx

Báo cáo y học: " A method for studying decision-making by guideline development groups" potx

... main analysis phase This involves systematically reducing data via application of a coding frame, developed from a broad thematic analysis of a subset of data, to extract data excerpts warranting ... collection and analysis of textual data to allow us to address the research questions of the EiR study [10] More finegrained analyses may be possible where non-verbal data is available, for example via ... integrating these stages into an overarching qualitative analysis Analysis is undertaken using a unique configuration of techniques drawn from various extant qualitative methodologies (thematic analysis...

Ngày tải lên: 11/08/2014, 05:21

9 408 0
w