a tool for the creation of tf orf resources

... aromatic amino acid catabolism ASP3 Asparaginase CCZ1 Autophagy DAL5 Allantoate metabolism DAL7 Allantoate metabolism DOA4 Regulates amino acid permease Gap1p GCN4 General control of amino acid ... transcript in the act of being translated (for example, associated with ribosomes) and the average spacing of ribosomes along a translating mRNA Across the entire transcriptome, the average fraction ... plotted against the fraction of each transcript in polysomes The data are those used to calculate the translational efficiencies in (a) The under-translated transcripts (

Ngày tải lên: 14/08/2014, 16:20

... extension of Cry4Aa is structurally similar to that of Cry1 [17] Eight of the 13 cysteines of Cry4Aa are located in the C-terminal extension These observations suggest that Cry1 and Cry4Aa have similar ... or more replicate experiments A 6xHis 4AaCter-TpN15 PP TpN15 B TpN17 4AaCter 4AaCter 4AaCter-TpN17 4AaCter 4AaCter-TpN47 4AaCter TpN47 4AaCter 4AaCter TpN15 TpN17 TpN47 ATG Ptac (kDa) 210 119 90 ... used the segment 696–851 of the C-terminal half of Cry4Aa as a peptide tag for the efficient production of T pallidum antigens (TpNs) This experiment was a touchstone to evaluate the usability of...

Ngày tải lên: 29/03/2014, 09:20

... patterns that are optimal for NMR spectroscopy SAIL amino acids are being commercialized by a start-up company in Japan (Sail Technologies, Inc., Yokohama, Japan) and when available will raise the threshold ... targets with a noncleavable His6 tag, with a cleavable His6 tag, and with a cleavable glutathione S-transferase (GST) tag and have shown complementary success with these [35] (b) Because of the ... cell-free method comparable to that of the E coli cell-based approach for NMR structure determinations of eukaryotic proteins One of the main advantages of the automated wheat germ cell-free protein...

Ngày tải lên: 07/03/2014, 12:20

... A re-examination of the available data from feeding trials with cattle on a variety of poor quality forages in various countries has major implications for the potential of using these abundant ... produces small amounts of milk for the calf and the family Sharing of the milk and/or early weaning of the calf are causes of ill thrift and early death of calves The supplementation strategies ... available forage and not strategically supplement their animals, probably have their first calf at 4-5years of age and produce a calf there after at intervals of a minimum of years Under the harsh conditions...

Ngày tải lên: 08/03/2014, 23:20

... 890 stems ha-1 at age years The stand basal area was about 19 m2 ha-1, which is average for fully stocked acacia stands: basal areas greater than 25 m2 ha-1 are uncommon in acacia plantations, even ... (Figure 6) operates a small sawmill at Dong Ha, which saws acacia wood as part of its log mix He buys acacia sawlogs from local plantations at the time of harvest operations and transports them to his ... farmers and smallholders harvested to date are of A auriculiformis and A mangium, because acacia hybrid cutting were not readily available and more expensive at the time of establishment of farmer...

Ngày tải lên: 21/06/2014, 06:20

... Porapak Q column Nitrogen has been used as carrier gas AIMIL’s Gas Chromatograph data station (DASTA-710) has been used in the analysis of GC data The concentrations of hydrogen and methane have ... proximate analysis of carbon samples All the carbon samples contain – 2.5 wt % of ash The ash content in coconut charcoal (AC3) is 1.0 wt % while that of the activated charcoals from hard wood (AC1) ... AC3 catalyst before/after experimentation The morphology and the crystalline data of the AC3 sample before and after the catalytic activity have been analyzed using SEM (Hitachi S-3700) and XRD...

Ngày tải lên: 05/09/2013, 15:28

... they have a mathematical format consistent with the underlying physicochemical processes This mathematically structured database can then be mathematically interrogated (step 3) Constraint-based ... engineering manipulation, the amount of violaxanthin was diminished dramatically, and in some cases, the monoepoxy intermediate, antheraxanthin, accumulated (Romer et al., 2002) Most of the transformants ... amplification, addition, or blockage of a particular pathway A new area is the manipulation of cofactors, which play a major role in plant biochemistry and physiology and in the fermentation process 24 A...

Ngày tải lên: 25/10/2013, 05:20

... version of ECUS software program will update the suitable new database version automatically You should back up the old database before doing update the new database version to avoide data lost If the ... Log in under another name: When you create a new declaration sheet, the program software will get the default data automatically Click on button "Đặt lại" to abort the default data then choose ... Keep the store devides at a safte place 47 6.10 Update database version: To restorethe backed up database, you can use function “DatabaseManager”, included in ECUS software program (C:\Program...

Ngày tải lên: 13/12/2013, 00:15

... facilities used for the preparation, packaging and storage of agricultural products before and after the operations concerning them; – all the practical measures to be taken at the level of the ... pulses and legumes, and aloe vera), seaweeds, and nuts and seeds07.0 Bakery wares12.7 Salads (e.g macaroni salad, potato salad) 416 Karaya Gum All Permitted, although exclusions of the GSFA still apply ... para 10 are satisfied; c) all the practical measures to be taken at the level of the unit to ensure compliance with these guidelines; d) the date of the last application on the land parcels and/or...

Ngày tải lên: 14/02/2014, 03:20

... facilities used for the preparation, packaging and storage of agricultural products before and after the operations concerning them; – all the practical measures to be taken at the level of the ... pulses and legumes, and aloe vera), seaweeds, and nuts and seeds07.0 Bakery wares12.7 Salads (e.g macaroni salad, potato salad) 416 Karaya Gum All Permitted, although exclusions of the GSFA still apply ... para 10 are satisfied; c) all the practical measures to be taken at the level of the unit to ensure compliance with these guidelines; d) the date of the last application on the land parcels and/or...

Ngày tải lên: 18/02/2014, 07:20

... Fujiwara T, Mitsui T, Yokogawa T, Okuni T, Nakayama H, Takio K, Yabuki T, Kigawa T, Kodama K, Yokogawa T, Nishikawa K & Yokoyama S (2002) An unnatural base pair for incorporating amino acid analogs ... have taken advantage of advances in cell-free translation systems The use of tRNA, mischarged with an unnatural amino acid through a chemical acylation method originally developed by Hecht et al ... provides a platform for simulating a complex cellular activity because the product of the system is the protein, the main player of the multiple cellular functions Yu et al [26] performed the first...

Ngày tải lên: 19/02/2014, 06:20

... http://www.fao.org/ag/aga/agap/frg/feedsafety/special.htm FAO (Food and Agriculture Organization of the United Nations) Animal Feed Resources Information System AFRIS http://www.fao.org/ag/AGA/AGAP/FRG/afris/tree/cat.htm ... Information on animal health and disease prevention is available from Animal Health Australia, at http://www.animalhealthaustralia.com.au/aahc/index.cfm?E9711767-B85DD391-45FC-CDBC07BD1CD4#ops and ... housing areas; disease to other parts of the facility or to other facilities The • Establish a detailed animal health program supported by procedures to protect against the spread of animal diseases...

Ngày tải lên: 21/02/2014, 01:20

... trust and openness The need to clarify the role of vaccination in the control of HPAI was noted, as was the need for a better understanding of the roles of wild birds and the transport and trade of ... States of America Animal Production and Health Division, Food and Agriculture Organization of the United Nations, Viale delle Terme di Caracalla, 00153 Rome, Italy SUMMARY The model of food animal ... types of aerial pollutants may exacerbate multi-factorial environmental diseases There are, however, few international field surveys paying attention to the health of the farmers and the farm personnel...

Ngày tải lên: 21/02/2014, 01:20

... Materials and Methods Materials A microalgal strain of C vulgaris was kindly provided by Prof Hong-Nong Chou of The Institute of Fisheries Science, National Taiwan University, Taiwan All solvents and ... cultivated in L normal nutrition medium and incubated batchwisely at 22oC The system was aerated at an air flow rate of L/min with or without the addition of pure CO2 gas The fermentor is agitated ... 48 MAKARA, TEKNOLOGI, VOL 13, NO 1, APRIL 2009: 47-51 energy crops [6-7] Microalgae systems also use far less water than traditional oilseed crops For these reasons, microalgae are capable of...

Ngày tải lên: 21/02/2014, 10:20

... Materials and Methods Materials A microalgal strain of C vulgaris was kindly provided by Prof Hong-Nong Chou of The Institute of Fisheries Science, National Taiwan University, Taiwan All solvents and ... cultivated in L normal nutrition medium and incubated batchwisely at 22oC The system was aerated at an air flow rate of L/min with or without the addition of pure CO2 gas The fermentor is agitated ... 48 MAKARA, TEKNOLOGI, VOL 13, NO 1, APRIL 2009: 47-51 energy crops [6-7] Microalgae systems also use far less water than traditional oilseed crops For these reasons, microalgae are capable of...

Ngày tải lên: 21/02/2014, 10:20

... printer Image display TAG TAG TAG Standard colour space Color transform for device to standard color space and from standard color space to device Ink jet printer TAG TAG TAG Digital camera Scanner ... isn't worth as much without them © FujiFilm 2002 Digital camera profile creation Measure target patch colors Obtain standard digital camera color target L *a* b* ICC Profile valid for profiled viewing ... to a standard © FujiFilm 2002 Profile testing • Accuracy – measure a profile's accuracy using a reference set of color patches – example IT8.7/3 basic set for a printer profile – Average and Maximum...

Ngày tải lên: 21/02/2014, 11:20

... and Gama, L.T Asadzadeh, N., Sadeghipanah, H., Sarhadi, F., Babaei, M., Banabazi, M.H and Khaki, M Sadeghipanah, H., Asadzadeh, N., Sarhadi, F., Banabazi, M.H., Babaei, M and Khaki, M Saủudo, ... Xata Roxa Ternera Roxa (www.viaganadera.com/prodycar) I G P Ternera Asturiana (www.terneraasturiana.org) I G P Carne de vila (www.carnedeavila.org) I G P Ternera de Navarra (www.terneradenavarra.com) ... Baqain, A and Valle Zarate, A Glasser, T .A. , Landau, S., Ungar, E.D., Perevolotsky, A. , Dvash, L., Muklada, H., Kababya, D and Walker, J.W Lauvie, A. , Lambert-Derkimba, A and Casabianca, F Kongsted,...

Ngày tải lên: 22/02/2014, 05:20

... sporting activities we always are happy to support them – ACAT is a socially committed company without any barriers and when Mrs Daniela Müller, a laboratory assistant at the Jass Schwarza GmbH, asked ... your great commitment during the last ten years for the ACAT team! Harald Reis: 15 Years Backstage Stefan Schaub - 15 Years Paper Technology Management and Administration for Central and Eastern ... the non – image areas of the blanket and worse at the trailing edge of the solid printed areas Linting can be caused by a number of factors: Excessive tack of the ink or blanket This is the force...

Ngày tải lên: 22/02/2014, 09:20

... poisoning can occur when coal or biomass is used in the creation of syngas An advantage of the TFBR is that only the upper portion of the catalyst may be poisoned, allowing the remaining catalyst ... the data was most readily available for the KAM2 pulp mill As a result, the KAM2 mill will be used as the baseline The attached calculations cannot currently be precisely duplicated and are for ... methanol synthesis catalyst and a methanol dehydration catalyst The methanol synthesis catalyst is generally a copper and/or zinc and/or aluminum and/or chromium based commercial catalyst while the...

Ngày tải lên: 26/02/2014, 14:20

... using primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG ... et al sequence verified and named pAff8eGFPLacUV5 and pAff8eGFPTrc, respectively The gene for the T7 promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and ... CGGTCACGAACTCCAGCAG, respectively The input of total RNA was lg A mixture containing total RNA, dNTPs (Invitrogen, Carlsbad, CA, USA) and pmol of each reverse primer was denatured at 70 °C for 10 and...

Ngày tải lên: 06/03/2014, 01:20