a tool for the assessment of risk
Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf
... distally along the shoe), medial (greater medial than lateral wear at the heel and forefoot), which may indicate excessive pronation, or lateral (greater lateral than medial wear at the heel and forefoot), ... reliability for all categorical items, use of these items from the tool to assist clinical footwear assessment can be recommended for a range of populations Qualitative evaluation of the tool and ... range of each measure across included footwear was also reported Intra-rater and inter-rater reliability for all categorical data was evaluated using percentage agreement, and kappa (κ) statistics...
- 12
- 379
- 0
Báo cáo hóa học: " Research Article A Framework for the Assessment of Temporal Artifacts in Medium Frame-Rate Binary Video Halftones" pot
... temporal artifacts in the halftone videos Therefore, perceptual quantitative measures for evaluating these artifacts are desirable Quantitative assessment of temporal artifacts can facilitate comparison ... This instantiation of the flicker assessment framework is depicted in Figure In Figure 9, K, Q, and R each have a value of L, and S have each a value of P has a value of −1 The “Artifact Map” is ... dirty-window-effect For the perceptual evaluation of each artifact, a particular instantiation of the generalized framework, was presented and the associated results were EURASIP Journal on Image and Video...
- 11
- 519
- 0
báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx
... precipitates The spectrum of the material reveals peaks for Ca and Sb The strong decrease of the Ca2+ pool in the pistil at the last stages of pistil development coincides with the degradation of the ... maximal values just after anther dehiscence (stage 4) At the latest analyzed stage (stage 5) a significant decrease of Ca2+ levels was observed in the upper parts of the pistil (stigma and style) ... exudates (arrowheads) (E) In the stigma of a flower without petals and anthers (stage 5), Ca/Sb deposits are less abundant and present mainly on the surface of degenerating papillae cells and...
- 12
- 529
- 0
Báo cáo y học: "The Sequence Ontology: a tool for the unification of genome annotations" potx
... searching and querying capa- interactions SO also greatly facilitates the automatic validation of annotation data, as the relationships implied by an annotation can be compared to the allowable ... separable England is a part _of Britain feature_part _of activity Functional/heteromerous/not separable Inhaling is a part _of breathing Translation is part _of protein synthesis A sheep is a part _of ... CG14478-RA CG14478-RB 3′ CG14478-RA CG14478-RB These data afford many potential analyses, but as our motivation was primarily to demonstrate the practical utility of SO as a tool for data management,...
- 12
- 299
- 0
Báo cáo khoa học: "A TOOL FOR THE AUTOMATIC CREATION, EXTENSION OF LEXICAL KNOWLEDGE" pdf
... verb form werkte (worked) (Records for citation forms contain pointers to the different forms belonging to their paradigm, and information relevant to all forms of a paradigm: e.g case frames and ... is ~ d ~ to the system, and we want to add all inflected forms (the paradigm of the verb) to the dictionary with their pronunciation As a first hypothesis, the system assumes that the inflection ... consists of the nucleus and coda of the last stressed syllable and the following weak syllables if any For example, the rhyme determining part of w~rrelea (to whirl) is er-ve-len, of versn6llea (to accelerate)...
- 5
- 467
- 0
báo cáo hóa học:" Development and validation of the Impact of Dry Eye on Everyday Life (IDEEL) questionnaire, a patient-reported outcomes (PRO) measure for the assessment of the burden of dry eye on patients" potx
... process of development and finalisation of the questionnaire They gave their approval at each of the milestones of the development and finalisation process The questionnaire was also reviewed and agreed ... IDEEL as distinct modules and the lack of data from PCA and Multi-trait analyses on the questionnaire as a whole could be raised as limitations, as the purpose of these analyses is to allow the ... on daily life and the patients’ satisfaction with their treatment as the central concepts in patients’ experience of dry eye Qualitative analysis indicated that saturation was achieved for these...
- 32
- 686
- 0
báo cáo hóa học:" Psychometric evaluation of a visual analog scale for the assessment of anxiety" pdf
... describes the psychometric evaluation of a patientreported VAS for the daily assessment of anxiety when used in a clinical trial assessing pharmaceutical treatments for GAD Methods Preliminary Qualitative ... reliable than asking for a rating at a specific point in time [38] A set of analyses was aimed at providing evidence of the reliability, responsiveness, validity, and utility of the GAVAS The GA-VAS ... corroborate the responsiveness of the GA-VAS Validity correlations between the GA-VAS and other available measures were highly satisfactory Specifically, the GA-VAS obtained relatively high correlations...
- 8
- 385
- 0
Báo cáo y học: "ChIPOTle: a user-friendly tool for the analysis of ChIP-chip data" docx
... above the significance cutoff, 'array density' of the peak, and the P value for that peak The array density value is defined as the average number of arrayed elements used to calculate the window ... window values for all windows that comprise the peak Therefore, the array density value provides an estimate of the number of actual raw data measurements that underlie each peak Properties of ChIP-chip ... correction As an alternative to using a Gaussian distribution for the background, ChIPOTle can estimate the P value for a region using a permutation-based approach (Additional data file 2) Using...
- 8
- 334
- 0
Implementation of a drug discovery tool for the evaluation of anti fibrotic compounds application in fibrovascular disorders
... a rapid cell enumeration assay that is suitable for the quantification of fibroblast population and suitable for a microplate reader analysis, to enhance the formation of collagen matrix on the ... Shanshan and the attachment students: Shriju Joshi, Amelia Ann Michael, Natasha Lee, Brenda Lim, Rosanna Chau, Srividia Sundararaman, Zhang Lei) and the Skin Cells Research Group members (Anandaroop ... having several disadvantages The first method can be laborious and involves hazardous materials and wastes, whereas the latter is nonspecific to collagen Therefore, an alternative collagen quantification...
- 74
- 224
- 0
Tài liệu Developing Culturally and Linguistically Competent Health Education Materials: A Guide for the State of New Jersey ppt
... overview of a patient's asthma control with a quick glance Patients assume active role in their health care Implementation: The Asthma Task Force developed an Asthma Test, Asthma Management Plan, and ... 1) In Navajo asthma patients, perceptions of asthma and beliefs about the activity of asthma medications influence when and how often asthma medicines are taken, as well as the use of health services ... within the health centers The Asthma Task Force developed medical record documents to facilitate superior asthma care (including an Asthma Test, Asthma Management Plan, and Asthma Action Plan),...
- 24
- 522
- 0
Tài liệu Guideline on Best Practice for the Audit of Risk in Public/Private Partnership (PPP) docx
... Salvador Peru Argentina Estonia Poland Australia Germany Romania Austria Hungary Russian Federation Bahamas India Saudi Arabia Bangladesh Israel Slovakia Brazil Slovenia Bulgaria Lithuania Turkey ... INTOSAI established a Working Group on the Audit of Privatisation The Working Group consists of representatives from the SAIs of 39 countries: Albania Egypt Paraguay Antigua and Barbuda El Salvador ... difficulties The key risks and their management Part 1: Risks facing the State A Clarity about partnership objectives Risk Managing the risk 1) The state is likely to have a range of public service...
- 30
- 441
- 0
Tài liệu Towards a framework for the study of the neural correlates of aesthetic preference pdf
... former case, there is the advantage of studying reactions to real art and the disadvantage that any two works of art differ from each other in several different respects, so that the actual factor ... et al., 2006) Another major difference among the three studies is the task that participants were asked to perform Kawabata and Zeki (2004) asked their participants to rate the beauty of the ... encompasses the region identified by Vartanian and Goel (2004), and has been related with the assessment of the relevance of motivational and emotional information and the regulation of emotional...
- 19
- 526
- 0
Báo cáo khoa học: " A Tool for Error Analysis of Machine Translation Output" doc
... of EAMT, pages 52–57, Saint Rapha¨ l, France e 61 Mary Flanagan 1994 Error classification for MT evaluation In Proceedings of AMTA, pages 65–72, Columbia, Maryland, USA Ariadna Font Llitj´ s and ... level→Long are selected in order to add a new error annotation B LAST ignores identical annotations, and warns the user if they try to add an annotation for the exact same words as another annotation ... lower-cased matching works for most languages, and stemming for 15 languages The synonym module uses WordNet, and is only available for English The paraphrase module is based on an automatic paraphrase...
- 6
- 479
- 0
Báo cáo khoa học: "QARLA:A Framework for the Evaluation of Text Summarization Systems" pdf
... framework, QARLA, that addresses such issues Given a set of manual summaries and another set of baseline summaries per task, together with a set of similarity metrics, QARLA provides quantitative measures ... estimates the quality of an automatic summary a ∈ A, given a set of models M and a similarity metric x An obvious first attempt would be to compute the average similarity of a to all model summaries ... compare the rankings produced by QARLA with the output of human assessments, even if the philosophy of QARLA is not considering human assessments as the gold standard for evaluation Our initial...
- 10
- 517
- 0
THE ATTRACTIONS OF RISK-BASED REGULATION: ACCOUNTING FOR THE EMERGENCE OF RISK IDEAS IN REGULATION docx
... misleading information and result in mistaken action (1998: 184- 5) Quantitative risk Assessments (QRA) have been the subject of a deal of academic criticism For instance, the mathematical basis of ... in a variety of ways For example, the causes of a risk may not be clear and even where they are clear the decision about what is an acceptable risk needs to be taken and that is essentially a ... employs a number of risk- based tools The 1988 approach involved risk assessments about such matters as plant reliability and risk of plant failures; quality of the plant and its operational procedures;...
- 21
- 533
- 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx
... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...
- 11
- 679
- 0
Báo cáo khoa học: "A Language for the Statement of Binary Relations over Feature Structures" ppt
... often the case that a grammar assigns just one of a range of logically equivalent representations to a sentence; designers of grammars for use in analysis generally take care to ensure that the ... translation application Similarly, the transfer rules of Zajac (1990) express a relation between subparts of a single complex structure Such an approach does not appear suitable for the appl/cation ... An alternative is to define equivalence classes of representations, and reduce all members of a class to the single canonical form which the grammar can map into a senfence Exactly how the classes...
- 6
- 347
- 0
báo cáo hóa học:" Botulinum toxin type A injections for the management of muscle tightness following total hip arthroplasty: a case series" pptx
... manuscript AB, MGZ, MSM, RED, MAM ensured the accuracy of the data and analysis All authors have read and approved the final manuscript Additional material Additional file Summary of patients treated ... to assess the clinical outcome Patients were also evaluated using the Harris hip score rating system [22] Statistical Analysis Data was subjected to averaging and analysis using Sigma Stat software ... holding the joint at the end of their range for 30 seconds, followed by manual application of 15 to 20 oscillations at the end range of motion All of the manual therapy was performed with opposite...
- 7
- 468
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 động cơ điện không đồng bộ một pha sự cần thiết phải đầu tư xây dựng nhà máy chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25