... article as: DiScioscio et al., Congenital cystic adenomatoid malformation of the lung associated with bronchial atresia involving a different lobe in an adult patient: a case report Journal of ... reduce the risk of infection or malignant transformation (bronchioloalveolar carcinoma) Bronchial atresia and CCAM usually involve the same lobe and, although it has been stated that congenital cysts ... at the right upper lobe The bronchial branch for the right upper lobe is not identifiable (b) Axial image of the right lower lobe allows the characterization of a malformed multicystic area of...
Ngày tải lên: 11/08/2014, 12:20
... Patient with diagnosis of endometrial osseous metaplasia 20 days after a spontaneous delivery The patient had had an abortion many years earlier Case report of endometrial osseous metaplasia associated ... Case report of a patient with dysmenorrhea, with two previous voluntary abortions and a diagnosis of endometrial osseous metaplasia, which was treated by hysteroscopic removal of the lesion, with ... implantation [10] Also supporting the presence of inflammation in cases of endometrial osseous metaplasia, it has been documented by Lewis et al [14] that the removal of bone fragments Page of...
Ngày tải lên: 11/08/2014, 17:21
Tài liệu Báo cáo khoa học: The distinct nucleotide binding states of the transporter associated with antigen processing (TAP) are regulated by the nonhomologous C-terminal tails of TAP1 and TAP2 ppt
... of 2C1 appears to have lost the ability to exchange ADP for ATP The specificity of ADP-binding was tested by the addition of free MgADP All TAP chains showed a 40–50% release at mM MgADP (data ... was created by ligation of the 1.6 kb ScaIfragment containing the C-terminus of TAP2 to the 3.8 kb ScaI-fragment containing the TMD and core NBD of TAP1 In the case of 2V1, the 1.8 kb ScaI-fragment ... TAP2 at position 1943 (position is the A of the first AUG) For TAP1 we used the complementary primers 5¢-GGACGATGCCACCAGTACTCTG GATGCTGGCAACC-3¢ and 5¢-GGTTGCCAGCATCC AGAGTACTGGTGGCATCGTCC-3¢ and...
Ngày tải lên: 20/02/2014, 02:21
Báo cáo hóa học: "Research Article Epileptic Seizure Prediction by a System of Particle Filter Associated with a Neural Network" doc
... variance can be calculated for 15–30 minutes before the peak; peak amplitude can be detected by the real peak value, and the width of peak can also be obtained at the same time We assume that ... these features will be kept the same at the next seizure onset All the features can be updated as long as the information of a new seizure is available Thus the system can adaptively update all ... it (with threshold of ±5% of the mean of previous variance), the peak amplitude (at least 10 more than the previous mean value), and the width of peak (from minute to minutes) The mean value and...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo y học: "Genome-wide analysis of primary CD4+ and CD8+ T cell transcriptomes shows evidence for a network of enriched pathways associated with HIV disease" pot
... cascade, another branch of the MAPK signaling pathway (Figure 6) All the aforementioned MAPK associated pathways are also top ranked in the LTNP group in other pairwise comparisons, although they ... APAF and hence activates CASP9 leading to the caspase cascade resulting in apoptosis G2 arrest and DNA damage signaling could also activate BAX leading to mitochondria-mediated apoptosis On the ... along the MAPK p38 cascade and NFKBIA associated with NFKB activation (Figure 6, Additional File 2), indicating the upregulation of p38 pathway In JNK MAPK and granule cell survival pathway, MAPK9...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo "LOCAL DIMENSION OF FRACTAL MEASURE ASSOCIATED WITH THE (0, 1, a) - PROBLEM: THE CASE a = 6 " pptx
... 1997 K J Falconer, Fractal Geometry, Mathematical Foundations and Applications,John Wiley & Sons, 1993 A Fan, K S Lau and S M Ngai, Iterated function systems with overlaps, Asian J Math 4(2000), ... Describle the local dimension for the (0, 1, a) - problem, where a ∈ N is a natural number Note that the local dimension is an important characteristic of singular measures For a = 3k + the measure ... n, where #A denotes the cardinality of set A (2) Local dimension of fractal measure associated with 33 Two sequences (x1 , x2 , , xn ) and (x1 , x2 , , xn ) in Dn are said to be equivalent, denoted...
Ngày tải lên: 14/03/2014, 13:20
Báo cáo khoa học: The unique pharmacology of the scorpion a-like toxin Lqh3 is associated with its flexible C-tail pdf
... construct HA-Lqh3 using the pET-14b vector as template DNA Primer 1, 5Â- GGCAGCCATATGTGTAATTGTAAGGCA CCAGAAACTGCACTTTGCGC-3Â, was designed to add a sequence encoding Apamin and a linker cleavable by ... mutagenesis and comparison of bioactive surfaces and overall structures of pharmacologically distinct toxins These analyses were based on available crystal structures of a- toxins and their mutants ... 7) Such a mechanism may also rationalize the broad-range potency of this toxin on insect as well as mammalian peripheral and brain Navs [5,16,18] A similar explanation might hold for the slow...
Ngày tải lên: 23/03/2014, 09:20
Báo cáo y học: "Angiogenic and angiostatic factors in systemic sclerosis: increased levels of vascular endothelial growth factor are a feature of the earliest disease stages and are associated with the absence of fingertip ulcers" doc
... inverse association of endostatin with giant capillaries and microhemorrhages and of the higher levels of endostatin in patients with avascular areas argue for a role of endostatin in the pathogenesis ... with some avascular areas, mild disorganization of the capillary architecture and absent or some ramified capillaries Finally, the late pattern criteria were irregular enlargement of capillaries, ... few or absent giant capillaries, absence of hemorrhages, severe loss of capillaries with large avascular areas, severe disorganization of the normal capillary distribution and frequent ramified/...
Ngày tải lên: 09/08/2014, 06:22
báo cáo khoa học: "The occurrence and management of fluid retention associated with TKI therapy in CML, with a focus on dasatinib" pptx
... http://www.jhoonline.org/content/2/1/46 Dasatinib Dasatinib is a thiazole carboximide with potent activity against BCR-ABL and also SFKs [15] This agent has 325fold greater activity against unmutated BCR-ABL in vitro than imatinib, ... may require thoracentesis and oxygen therapya Figure The management of pleural effusion emerging on treatment with dasatinib The management of pleural effusion emerging on treatment with dasatinib ... similar rates of edema Pleural effusions is uncommonly associated with nilotinib therapy (1%) [30] Management of these AEs is best treated with dose interruptions, and therapy can be resumed at the...
Ngày tải lên: 10/08/2014, 22:20
báo cáo khoa học: "Eosinophilic pneumonia associated with daptomycin: a case report and a review of the literature" pptx
... crackles at the lower pulmonary fields bilaterally, a 4/6 diastolic heart murmur at the lower left parasternal area and a 4/6 systolic heart murmur at the right upper parasternal area Laboratory studies ... significant hypoxemia with arterial blood gases analyses revealing a pH of 7.44, an oxygen saturation of 88%, a partial pressure of oxygen of 58 mmHg and a partial pressure of carbon dioxide of 38 mmHg, ... X-ray demonstrating bilateral perihilar alveolar edema with a “butterfly” appearance and bilateral pleural effusions b Chest X-ray after pharmaceutical treatment for the congestive heart failure...
Ngày tải lên: 11/08/2014, 03:20
Báo cáo y học: " The first description of severe anemia associated with acute kidney injury and adult minimal change disease: a case report" ppsx
... content of the paper EF interpreted patient data and the literature and critically reviewed the content of the paper All authors read and approved the final manuscript Acknowledgements The renal biopsy ... all the improvement, the unusual and dramatic recovery raises the possibility that the early use of EPO may have facilitated the recovery of renal function In combination with the experimental ... Conclusion Adult MCD may present with severe ARF, significant anemia and a normal lipid profile Severe anemia associated Page of (page number not for citation purposes) Journal of Medical Case Reports...
Ngày tải lên: 11/08/2014, 19:21
Báo cáo y học: "The first report of human illness associated with the Panola Mountain Ehrlichia species: a case report" doc
... report that an emerging pathogen, the Panola Mountain Ehrlichia species, was detected in blood from a human patient following the bite of a nymphal Amblyomma that was probably acquired at Panola Mountain ... September was unremarkable Pyrexia was not observed and no erythema or edema was noted at the site of the tick bite; however, the patient had taken 500 mg aspirin prior to examination The patient was ... removed and sequences assembled with Seqmerge (Accelrys, San Diego, CA) Case presentation On 23 September 2005, a 31-year-old Caucasian man from Atlanta, Georgia, USA presented with a complaint of...
Ngày tải lên: 11/08/2014, 23:21
Báo cáo y học: "A prospective study of tracheopulmonary complications associated with the placement of narrow-bore enteral feeding tubes" doc
... patients are summarized in Table A cuffed endotracheal tube was in place in 13 out of these 14 patients All patients were receiving sedatives at the time of feeding tube placement The one patient ... would allow identification of all cases To place the risks associated with feeding tube placement into perspective, the probability of pneumothorax with central line insertion is in the 1-2% range ... requires the placement of the tube in the esophagus to the level of the xiphoid and confirming the position with a chest roentgenogram If the position is acceptable (midline), the tube is then advanced...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo khoa học: "A farm-level study of risk factors associated with the colonization of broiler flocks with Campylobacter spp. in Iceland, 2001 – 2004" pot
... relative to the residuals of the other farms The characteristics of this farm were: non-official water, one house, an all-in-all-out system, manure was spread and stored at all times of the year, ... models that employed a backward elimination approach had slightly smaller AIC's and a larger number of significant predictors than those using a forward approach Backward selection has an advantage ... the farm Protective factors included the use of official or official treated water on the farm compared to the use of non-official untreated water, storing manure on the farm at any time of year,...
Ngày tải lên: 12/08/2014, 18:22
Reading Theory as a Microcosm of the Four Skills
... teachers as they are the backbone of many schools in Ireland and Britain One of the most important initial tasks for any teacher is the task of knowing his clients The notion of needs analysis is absolutely ... central Even with as few details as we have outlined above, there are certain things that we can assume about this group First, given their age group, it is reasonable to assume that many of them ... different, they now find themselves on a (reasonably) level playing field, culturally, linguistically and in many other ways too It is this that the teacher must take advantage of All of the group...
Ngày tải lên: 06/09/2013, 10:10
Risks Associated with Overcollection of Medicinal Plants in Natural Habitats
... 1996b) The Wrigley Memorial and Botanical Gardens at Catalina Island, CA, is still another example The garden places its emphasis on California island endemic plants Many of these plants are extremely ... region and the Athabascans of Interior Alaska Wormwood has been used traditionally for many of the same purposes as devil’s club, although it belongs to the family Asteraceae and is, taxonomically, ... ecologically sustainable forest management In Madagascar, the WWF brokered a debt-for-nature swap which has trained more than 350 local conservation agents and created a network of locally managed...
Ngày tải lên: 25/10/2013, 05:20
Tài liệu Báo cáo "REMARKS ON LOCAL DIMENSION OF FRACTAL MEASURE ASSOCIATED WITH THE (0, 1, 9) - PROBLEM " pdf
... appear) 11 Le Xuan Son, Pham Quang Trinh and Vu Hong Thanh Local Dimension of Fractal Measure associated with the (0,1 ,a) -Problem, the case a = 6.Vietnam National university, Hanoi, N1 (2005), ... Hu and N Nguyen, Local dimensions of fractal probability measures associated with equal probability weight, Preprint T Hu, N Nguyen and T Wang, Local dimensions of the probability measure associated ... if and only if it contains (1, a, 0) or (0, a, 9), for any a ∈ D Proof It is easy to see the proof of this claim By Claim 3.3, we call each element in the set {(1, a, 0), (0, a, 9)}, for any a...
Ngày tải lên: 13/02/2014, 04:20
Báo cáo " SINGULARITY OF FRACTAL MEASURE ASSOCIATED WITH THE (0, 1, 7) - PROBLEM " potx
... overlaps,J London Math Soc ( to appear) 10 Le Xuan Son, Pham Quang Trinh and Vu Hong Thanh Local Dimension of Fractal Measure associated with the (0,1 ,a) -Problem, the case a = 6.Journal of Science, ... , for all n, we have # t3n+1 G3n+1 for all n By repeating the above argument and using the two above results we have the last of the assertion The proposition is proved Proof of The Main Theorem ... log The paper is organized as follows In Section we establish some auxiliary results used in the proof of the Main Theorem The proof of the Main Theorem will be given in the last section Some Auxiliary...
Ngày tải lên: 05/03/2014, 14:20
RISK OF PULMONARY TUBERCULOSIS ASSOCIATED WITH EXOGENOUS REINFECTION AND ENDOGENOUS REACTIVATION IN A SOUTH INDIAN RURAL POPULATION-A MATHEMATICAL ESTIMATE* doc
... suggestions at the draft stage of the paper, Mrs.Anuradha for statistical assistance, Miss T.J Alamelu for secretarial help and Mr B.R Narayana Prasad graphics References Krishnamurthy, VV, Nair, SS, ... It was found that 64 new cases could have been diagnosed as against 57 actually diagnosed The risk of disease associated with the cited different types of tuberculosis infection is given in Table ... NI × A + RI × B + NRI × C = Total new cases where A, B and C are the risks of disease associated with new infection, reinfection and endogenous reactivation respectively and the abbreviations...
Ngày tải lên: 06/03/2014, 04:20
Báo cáo khoa học: "A COMFUTATIONAL THEORY OF THE FUNCTION OF CLUE WORDS IN ARGUMENT UNDERSTANDING" potx
... any case at any rate after all in spite o f that meanwhile rather than I would rather say The alternative is [Note 77 and 78 are whole phrases] II Attitudinal expressions These adverbs indicate ... playground's safe EXAlt: 1 )The city is awful ~/I\4 2)First, no one cleans the parks 3)So the parks are ugly I \ 4)Then the roads are a mess 5)There's always garbage there Here, and contain the clues; and ... to the specifications of the hybrid transmission There is an additional problem, due to the fact that evidence is treated as a transitive relation Sons are to be attached to their immediate father;...
Ngày tải lên: 08/03/2014, 18:20