a theory of deterministic queuing systems for the internet

... tree. Yang and Liu [8] have studied a strong law of large numbers for the frequency of occurrence of states for Markov chains field on a Bethe tree (a particular case of tree-indexed Markov chains ... shizhiyan1984@126.com 1 Faculty of Science, Jiangsu University, Zhenjiang 212013, China Full list of author information is available at the end of the article Abstract In this paper, we are to establish ... denoted by |A| thenumberof vertices of A, x A is the realization of X A . Let (, F ) be a measure space, {X t , tÎT} be a collection of random variables defined on (, F ) and taking values in G

Ngày tải lên: 20/06/2014, 23:20

... (3 citations on pages: 52, 53, and 54) [93] P Klock and R Mittra On the solution of the brillouin (k-b) diagram of the helix and its application to helical antennas In Antennas and Propagation ... citation on page 83) [107] J D Kraus and R Marhefka Antennas for all Applications McGraw-Hill, 2001 (7 citations on pages: 84, 115, 139, 142, 143, and 145) [108] S Schelkunoff Antennas: Theory and ... European, pages 194–197, 1969 (2 citations on page 53) [95] A R Neureuther, P Klock, and R Mittra A study of the sheath helix with a conducting core and its application to the helical antenna Antennas

Ngày tải lên: 27/04/2020, 09:09

... skills The teachers may adapt some more activities to attract the students in learning process It is suggested that teacher may take into the consideration of using diary keeping as a media to offer ... Language Learning and Teaching Palgrave Macmillan 29 Long, M (2014) Second Language Acquisition and Task-Based Language Teaching Wiley-Blackwell 30 Majchrzak, O (2018) Learner Identity and Learner ... the tasks Participation The teacher encourages the students' participation Yes No Comment 82 The students actively take part in each class activity The teacher offers chance for students to ask

Ngày tải lên: 01/08/2021, 16:05

... generalization of that result is given for the case that sampling is not uniform The boundedness of the state-trajectory solution at sampling instants guarantees the global boundedness of the ... of hybrid multirate sampling linear systems, ” Computers & Mathematics with Applications, vol 31, no 1, pp 109–122, 1996 P T Kabamba and S Hara, “Worst-case analysis and design of sampled-data ... solutions for all time The existence of a fixed point for the sampled state-trajectory solution at sampling instants guarantees the existence of a fixed point of an extended auxiliary discrete system and

Ngày tải lên: 21/06/2014, 20:20

... traditional approaches to systems development, such as those adopted for organizational databases for instance, may not be appropriate. For example, with traditional systems, the domain data ... 302 A FRAMEWORK OF KNOWLEDGE MANAGEMENT SYSTEMS: ISSUES AND CHALLENGES FOR THEORY AND PRACTICE 1 Jungpil Hahn Mani R. Subramani Carlson School of Management University of Minnesota U.S .A. Abstract ... Ohsawa, T., Okada, K., and Matsushita, Y. ? ?A Virtual Office Environment Based on a Shared Room Realizing Awareness Space and Transmitting Awareness Information,” in Proceedings of the Tenth Annual

Ngày tải lên: 30/06/2014, 21:16

... (Poggi-Varaldo et al., 2014; Moraes et al., 2015) Compared with other available approaches, AD enables a more efficient use of raw materials, as the treatment plants may be characterized as additional ... associated to the commercialization of carbon credits are two of the main limitations for the dissemination of anaerobic processes as an attractive choice for the management of vinasse within the ... plants rather than a residual stream, with great potential toward the application of anaerobic processes Anaerobic digestion (AD) constitutes an effective alternative to the management of vinasse

Ngày tải lên: 04/01/2018, 22:41

... capable of many different kinds of learning We suggest taking Squire’s (1992) classification as a way of measuring whether the theory can account for the range of human learning The major categories ... phenomena in a way that explains why they are functional aspects of human cognition 2.9 Learning Learning seems another uncontroversial criterion for a theory of human cognition A satisfactory theory ... that one might ask of a theory of human mind, they certainly are enough to avoid theoretical myopia While Newell certainly was aware of the importance of having theories reproduce the critical

Ngày tải lên: 18/10/2022, 04:40

... mph, and the WARR pod made it all the way down the track and was viewed as the top performer Needless to say, none of the material in the paragraph above is covered in standard undergraduate engineering ... In general, three approaches were taken, and these were all accommodated by the SpaceX test track The track has a concrete floor, a central aluminum Ibeam (6061) and aluminum plates on each side ... began to form in the mind of a faculty member who is also the primary author of this paper Having had seven years of experience in the aerospace industry with Hughes Aircraft Company, Space and

Ngày tải lên: 01/11/2022, 23:46

... Robson, David Traxel, Barbara Bendl, David Kerrick, Salar Alsardary, Durai Sabapathi, Tarlok Aurora, Ping Cunliffe, Amy Kimchuk, Lia Vas, Greg Manco, Bernard Brunner, Charles Samuels, Roy Schriftman, ... site at www.wiley.com Library of Congress Cataloging-in-Publication Data: Halpern, Paul, date The great beyond : higher dimensions, parallel universes, and the extraordinary search for a theory of ... Wünsch Thanks also to Jürgen Renn and Anne J Kox, who offered their friendly support The Philadelphia Area Seminar on the History of Mathematics has been a great source of guidance I thank the members

Ngày tải lên: 20/04/2023, 03:31

... process of development and finalisation of the questionnaire They gave their approval at each of the milestones of the development and finalisation process The questionnaire was also reviewed and agreed ... on daily life and the patients’ satisfaction with their treatment as the central concepts in patients’ experience of dry eye Qualitative analysis indicated that saturation was achieved for these ... controls The majority of the population was Caucasian female and the mean age was 51 years (range: 20-89 years) Follow-up pairwise t-tests showed that the group of controls was significantly younger

Ngày tải lên: 20/06/2014, 15:20

... no quantitative comparison for any reference dataset being available. Statistically nonstationary EEG signals yield temporal and spatial information about active areas within the brain andhavebeeneffectively ... central and occipital areas of the brain. In our approach, the multichannel EEG data are trans- formed into time-frequency domain. This gives the two-way EEG recording, that is, the matrix of space(channel)-time, ... 3.3. Performance evaluations In order to provide a quantitative measure of performance for the proposed artifact removal method, the CC values of the extracted eye-blink artifact source and the original

Ngày tải lên: 21/06/2014, 22:20

... progress, and decay, of vegetable and animal life, of instinct and of mind In the abyss of space, it is also forming new suns, and solar systems, and worlds that are to pass through the same ... constant relation to each other; as the scenes shifted, the inhabitants also changed, the latter being always adapted to the circumstances in which they were placed There has been a constant ... qualities of matter have built up a solar system, they may have created, also, the first animalcule, the first fish, the first quadruped, and the first man There has been a marked

Ngày tải lên: 28/06/2014, 19:20

... Richmond, VA, 2328 4; Center for Discrete Mathematics and Theoretical Computer Science, Rutgers, Piscataway, NJ 08854. Email: dcranston@vcu.edu † Department of Mathematics, College of William and Mary, ... discharging rules, whereas the lemmas are statements about any 1-ID code in the infinite hexagonal grid. So to simplify the proof of the main result, we defer the proofs of the five structural lemmas ... Karp ovsky, Chakrabarty, and Levitin [6] considered the 6-regular, 4-regular, and 3-regular infinite grids that come from the tilings of the plane by equilateral triangles, squares, and regular

Ngày tải lên: 08/08/2014, 01:20

... estimated by the LAI-2000 PCA; (4) diazo papers give an estimate of the integrated photosynthetically active radiation over a day - time exposure (PAR int ). The calculations of PAI and DIFN by the ... 50] have shown pre - cisely that the indirect methods often lead to a bias, yet are able to assess temporal and spatialrelativevariations. The relationship between a variable measured at the sampling ... understorey situation and by the weak range of variation that... distances as small as 50 cm for both the LAIL and the diazo paper; on the contrary Nicotra et al [32] detected spatial dependence

Ngày tải lên: 08/08/2014, 14:21

... for LDHA and VIL1 are probably due to the fact that these genes belong to large gene families and therefore suggest that they may not be the most appropriate markers for a standardisation effort. ... CTTGTGTGATTAACTTATTTAGAG and RB1R: AATGTGAACTTAGTAGCAAAAGAC derived from the human sequence L11910 were used to amplify bovine genomic DNA. Unfortunately, as these PCR primers amplify a product of similar size ... effort. This panel of BACs is available to the scientific community and has served as a basis for the establishment of a revised standard nomenclature of bovine chromosomes. bovine / BAC library / cytogenetics

Ngày tải lên: 09/08/2014, 18:21

... important is that the growing awareness on those biases has paralleled a more fundamental change in the goals of ethnopharmacology Namely, the initial bias towards the chemical, biological, and pharmacological ... cultural consensus theory to have a broader look at intracultural variation and at the analysis of transmission and loss of traditional ethnopharmacological knowledge Conclusions: Ethical considerations ... consensus analysis would allow ethnopharmacologists a broader look at intracultural variation and at the analysis of transmission and loss of traditional ethnopharmacological knowledge Cultural consensus

Ngày tải lên: 10/08/2014, 09:21

... Hospital Maastricht, the Netherlands, an ambulatory sur- gery programme for breast cancer was developed and eval- uated under the title of 'Breast pathology treated in day care: blessing or a ... independent variables were the 17 potential barriers and facilitators to the imple- mentation of the guideline for breast cancer surgery in day care. We calculated the relative importance of the attributes ... when they think of breast cancer surgery in day care. Also, the cooperation of the ward nursing staff and management was considered highly important. Cooperation of patients and patient organizations

Ngày tải lên: 11/08/2014, 05:21

... impose variable delays (queueing). In a number of cases, it is important to evaluate separately the total delay and the variable part of the delay. The total delay is important, for example, for ... empty. Data from the flow R(t) has to pour into the bucket an amount of fluid equal to the amount of data. Data that would cause the bucket to overflow is declared non-conformant, otherwise the data is ... section, we assume that σ(t) ≥ l max for t>0. Thus, for practical cases, we have to assume that the arrival curve σ has a discontinuity at the origin at least as large as one maximum packet size. How...

Ngày tải lên: 31/03/2014, 22:20

... the axiomatic standards of behavior governing our dealing with colleagues and going about our work. The Rules are available from the office of the associate managing editor for news administration. ... must annually affirm to the chief financial officer of The Times Company that they have no financial holdings in violation of paragraphs 125-127 or any other provision of these guidelines. They ... discounts available to the general public. Normally they are also free to take advantage of conventional corporate discounts that the Times Company has offered to share with all employees (for example,...

Ngày tải lên: 06/03/2014, 11:20

... her character. And respect for the value of non-human creatures and of the natural relations among them seems to many a mark of virtue. One of the attractions of a broad conception of moral virtue ... virtue and judgments of obligation. One is that the former are evaluations of character while the lat- ter are evaluations of action. And the value of an act can certainly diverge from the value of ... designation of the parts of ethical theory that are centrally engaged, in a general way, in actual ethical evaluation. That is because ‘normative’ too easily suggests that the whole subject matter...

Ngày tải lên: 11/06/2014, 05:28