... and face masks that can be manufactured The CDC and WHO are actively promulgating behavioral changes that can reduce the circulation of influenza [17] Further education and preparation of health ... H and N antigens Given only a few months, and a worldwide capacity of only about 500 million doses of human vaccine using present methods, use of vaccine and antivirals must be rational and carefully ... care workers and first responders to deal with an influenza pandemic is critical Only a physician over 60 years of age was even in medical school when the last and mildest influenza pandemic took...
Ngày tải lên: 12/08/2014, 04:21
... negative band at approximately 240 nm, whereas antiparallel G4 structures, such as basket and chair forms, show two positive bands at approximately 295 and 240 nm and a negative band at approximately ... Slovaˇ (Fisher Slovakia, Levoca, Slovakia) T4 polynucleotide kinase was purchased from Promega (Madison, WI, USA) [c-32P]ATP was purchased from Amersham (Arlington Heights, IL, USA) Cisplatin and ... was maintained at D220–330 in the range 0.2–0.8, and the CD data represent three averaged scans taken at an experimental temperature (25–90 °C) All CD spectra are baselinecorrected for signal...
Ngày tải lên: 23/03/2014, 06:20
the phenomenon of science a cybernetic approach to human evolution - turchin v.f
... disappear in toto and sometimes break into parts which disappear and reappear independent of one another Figure 2.5 Fragmentation of a stabilized image Fragmentation does not occur chaotically and ... information, however, has an exact quantitative meaning Let us imagine two subsystems A and B The two subsystems are interconnected in such a way that a change in the state of A leads to a change ... copy book was scanned and converted to HTML by An Vranckx and Francis Heylighen, and from there to PDF by Allison DiazForte The pagination and layout are not identical to the original The following...
Ngày tải lên: 08/04/2014, 12:58
báo cáo hóa học: " Human-machine interfaces based on EMG and EEG applied to robotic systems" pot
... Vitoria, Brazil, and National University of San Juan, San Juan, Argentina, through the binational program CAPG-BA As part of this financial support, Andre Ferreira got a scholarship to stay six ... necessary to use the BCI and to learn how to manage the mental states associated to concentration and relaxation of the visual area of the brain As it can be seen, most of the individuals learnt ... application and cost Methods Experiments based on muscular and cerebral activities are here accomplished in order to verify that a human operator is capable to command robots through Human- Page of...
Ngày tải lên: 19/06/2014, 10:20
Báo cáo hóa học: " Research Article A Combined PMHT and IMM Approach to Multiple-Point Target Tracking in Infrared Image Sequence" pdf
... and Data Association, Academic Press, San Diego, Calif, USA, 1988 [2] S Blackman and R Popoli, Design and Analysis of Modern Tracking Systems, Artech House, Boston, Mass, USA, 1999 [3] J B Pearson ... 247–258, Orlando, Fla, USA, April 1998 [22] T Kirubarajan and Y Bar-Shalom, “Kalman filter versus IMM estimator: when we need the latter?” IEEE Transactions on Aerospace and Electronic Systems, vol ... validation gate of size 28 × 28, and so forth It is obvious that with such a large validation gate and a large number of targets, the data association problem is very crucial and needs an efficient...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo hóa học: " A Constrained Least Squares Approach to Mobile Positioning: Algorithms and Optimality" pot
... TDOA, RSS, and AOA measurements (A1 ) All measurement errors, namely, {nTOA,i }, {nTDOA,i }, {nRSS,i }, and {nAOA,i } are sufficiently small and are modeled as zero-mean Gaussian random variables ... the antenna height and antenna gain, and a is the propagation constant Note that the propagation parameter a can be obtained via finding the path loss slope by measurement [22] In free space, a ... propagation parameter a is known and has a constant value for all RSS measurements (A3 ) The numbers of BSs for location using the TOA, TDOA, RSS, and AOA measurements are at least 3, 4, 3, and 2, respectively...
Ngày tải lên: 22/06/2014, 23:20
An Experimental Approach to CDMA and Interference Mitigation phần 1 pps
... Specifically, TDMA channels are allocated to a single carrier, and the different carrier are spaced 200 kHz apart Both with TDMA and with FDMA all channels can not be used in each cell, since that arrangement ... mobility and handovers With WLANs laptops, palmtops, possibly portable mp3 players and/ or videoterminals, are all linked together, either via a central access point in a star topology (with immediate ... Telecommunications His main research interests are x An Experimental Approach to CDMA and Interference Mitigation in mobile and satellite communications, synchronization and spreadspectrum systems Marco...
Ngày tải lên: 07/08/2014, 20:23
An Experimental Approach to CDMA and Interference Mitigation phần 2 potx
... the same as in a conventional matched filter narrowband receiver Actually, from (2.60) we see that the cascade of despreading and accumulation can be seen also as the computation of a correlation ... 1-13, a typical wireless transceiver combines a data pipe, which gradually transforms the bit serial data stream coming from the Analog to Digital Converter (ADC) into a set of complex data messages, ... by appropriate tools that allow the joint design and verification of heterogeneous hardware and software Particularly, owing to the exponential increase of both design gate counts and verification...
Ngày tải lên: 07/08/2014, 20:23
An Experimental Approach to CDMA and Interference Mitigation phần 3 pdf
... concurrently active channels is too low to serve a large users population like we have in a large metropolitan area, or a vast suburban area This also applies to conventional FDMA or TDMA radio networks ... filtering are digital, and the ‘sampler’ is just a decimator/interpolator that changes the clock rate of the digital signal The ADC conversion rate of r (t ) is, in fact, invariably faster than the ... correlation properties by Sarwate and Pursley [Sar80] and in the survey on spreading codes for DS-CDMA by Dinan and Jabbari [Din98]) Let us now compare, in terms of capacity, the spreading arrangements...
Ngày tải lên: 07/08/2014, 20:23
An Experimental Approach to CDMA and Interference Mitigation phần 4 pdf
... band pass limiting and amplitude control of the IF received signal prior to Analog to Digital Conversion (ADC), and a digital processing unit devoted to SNIR (Signal to Design of an All Digital ... with particular emphasis on the multi-rate CDMA demodulator and to the interference mitigation functionality 1.1 Multi-Rate CDMA Signal As already detailed in the previous Chapter, the signal at ... phase at the accumulator output can not have n pha nacc because of speed limitations in the access to the LUT, therefore only the n pha MSBs of the accumulator (with n pha nacc ) are read out to...
Ngày tải lên: 07/08/2014, 20:23
An Experimental Approach to CDMA and Interference Mitigation phần 5 doc
... DS/SS signal Actually, both in narrowband and in SS modulations one has to determine the carrier frequency with an accuracy much smaller than the symbol rate to ensure good data detection Clearly ... instance, it can be shown [Syn98] that a carrier frequency offset equal to half the symbol rate yields a coherent integration loss of about dB, and far higher losses have to be taken into account ... and (which in the following will be also referred as CPRU and CPRU , respectively) can be related to the noise loop (as is bandwidth BL and to the loop damping factor When BLTs always the case)...
Ngày tải lên: 07/08/2014, 20:23
An Experimental Approach to CDMA and Interference Mitigation phần 6 docx
... drift and indefinitely increase, thus causing in the long run saturation and failure of the detector To prevent this, it is mandatory to calculate the error signal ee (based on the quantized values ... enough to sufficiently ‘decorrelate’ the additional noise terms owing to the diverse degradation factors The SNR degradation is anyway smaller than dB in any tested configuration, and is particularly ... outcome of a thorough overall FP receiver simulation also including AFCU and CPRU In particular, the AFCU step size was set to AFCU 19 and the initial frequency error to As is apparent from...
Ngày tải lên: 07/08/2014, 20:23
An Experimental Approach to CDMA and Interference Mitigation phần 7 potx
... technologies such as FPGA (field programmable gate array), gate array, standard cell and full custom layout are currently available From top to bottom, the integration capability, performance, non-recurrent ... output database was transferred via Electronic Database Interchange Format (EDIF) to the Altera MAX+Plus IITM tool where it was utilized as a starting point for the final pad assignment and fitting ... of abstraction Many rapid prototyping environment are available on the market for system emulation (such as Cadence [Smi97], Aptix [aptix], FlexBench [Pav02], Nallatech [nalla] and Celoxica [celox])...
Ngày tải lên: 07/08/2014, 20:23
An Experimental Approach to CDMA and Interference Mitigation phần 8 ppsx
... Fully stackable vias and contacts; Thin gate oxide (35 Angstrom); Shallow Trench Isolation between active regions, improving transistor density and planarity; Salicided active areas and gates (to ... limited layout with non-critical placement and routing operations Table 5-9 Synthesis results Total area (RAM + standard cells) RAM area Standard cells number (without clock tree) Fault coverage Maximum ... symbols are built by adding to the standard correlator output a correction term obtained with the adaptive vector xe A further block implements the vector adaptation rule, and a SRAM stores the...
Ngày tải lên: 07/08/2014, 20:23
An Experimental Approach to CDMA and Interference Mitigation phần 9 potx
... 220 Chapter the whole ASIC layout in GDSII format A final parasitic parameters extraction was performed to obtain a Standard Parasitic Format (SPF) file for additional post-layout timing analysis ... IF channel filtering via an appropriate SAW filter, and signal amplitude automatic control to regulate the total received power as well as a suitable level for the subsequent Analog to Digital ... transmit and receive clock speeds The available bit and chip rates of the CDMA signal are shown in Table 6-1 The parameters of the CDMA signal are passed to the FORTRAN program by means of a...
Ngày tải lên: 07/08/2014, 20:23
An Experimental Approach to CDMA and Interference Mitigation phần 10 ppt
... autocorrelation data 25 off-zero 48 partial 44 automatic carrier frequency control unit 82 automatic gain control 140 average case user location 60 AWG See also arbitrary waveform generator AWGN See also ... terrestrial network, and ii) acting as a gap-filler in poorly covered areas Thus, the design and lowcost implementation of dual-mode terminals operating on similar carrier frequencies appears a mandatory ... V.K Bhargava, Q Wang, “Concatenated Orthogonal/PN Spreading Sequences and Their Application to Cellular DS-CDMA Systems with Integrated Traffic”, IEEE Journal on Selected Areas in Communications,...
Ngày tải lên: 07/08/2014, 20:23
báo cáo khoa học: " The NIHR collaboration for leadership in applied health research and care (CLAHRC) for Greater Manchester: combining empirical, theoretical and experiential evidence to design and evaluate a large-scale implementation strategy" pptx
... systemically shared, collected, and analysed to add to the wider knowledge base about effective implementation As highlighted above, each pair of KTAs is linked to a clinical and academic lead and ... initiative: academics and practitioners, managers and clinicians, commissioners and providers, professionals and the public, to name just a few At both the planning stage of implementation and ... research, namely translating ideas from basic and clinical research into the development of new products and approaches to treatment of disease and illness, and implementing those new products and...
Ngày tải lên: 10/08/2014, 11:20
Báo cáo khoa học: "A Medical Emergency Team syndromes and an approach to their management" ppsx
... between all the authors of this manuscript The 'A to G' approach to managing a MET call was subsequently developed to achieve these minimal standards Finally, the 'A to G' approach was adapted to ... period Approach to the management of a MET call An approach to the management of a MET call was developed with the acronym 'A to G' (Table in Additional file 1) The members of the MET are encouraged ... the management of MET calls and provides an educational framework for the management of acutely unwell ward patients Further evaluation and validation of the approach are required Key messages...
Ngày tải lên: 12/08/2014, 23:21
Báo cáo y học: "A BAC clone fingerprinting approach to the detection of human genome rearrangements" docx
... bioinformatics leads, project management JS: laboratory lead, project management MM, CC: principal investigator, laboratory lead, project management All authors have read and approved the final manuscript ... and analysis RC, RC, MF: data analysis DL: protocol development, laboratory fingerprint generation TP: PCR and sequencing SV: ESP data and experiment lead and collaboration AS, SJ: bioinformatics ... GGGGCCCTTTAGTGCCTTAG AATTGCCAAGTCAGAGGCAG 4,686 5,251 (+565) B TACTTACGGCAGAGGTTGGG TCTGATTTTGGAGCTTTTGG 6,411 6,017 (-394) A CTTGGGTTGGGAACTGAAAG CCTCTTCTGGGACTGCTGAC 28,006 4,925 (-23,081) C CCCACCAATGGATTACAACC...
Ngày tải lên: 14/08/2014, 08:20
A Cognitive Meta-Linguistic Approach to Teaching L2 Learners Reading and Writing Skills
... this approach are largely drawn from suggestions made by authors of the clause relational approach to text analysis such as McCarthy (1991) [50], McCarthy and Carter (1994) [19], Crombie (198 5a ... perspective Classroom activities used in the method are designed based on suggestions made by authors of the clause-relational approach to textanalysis such as McCarthy (1991) [50] and McCarthy and Carter ... Clause relations and types of clause relations Learners are expected to grasp the concept of clause relations and types of clause relations to assist them in approaching their reading and writing...
Ngày tải lên: 24/06/2015, 08:16