a systematic approach for better vaccines

Báo cáo y học: "A systematic approach for the identification of novel, serologically reactive recombinant Varicella-Zoster Virus (VZV) antigens" ppsx

Báo cáo y học: "A systematic approach for the identification of novel, serologically reactive recombinant Varicella-Zoster Virus (VZV) antigens" ppsx

... (one -for- all) primer set: One -for- all-forward: 5’-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3’ and One -for- all-reverse: 5’-GGGGACCACTTTGTACAAGAAAGCTGGGTC-3’ PCR products containing VZV-ORFs and functional attB-sites ... small format, ELISAs assays, data analysis and Page of wrote the manuscript KIP carried out large scale protein purification, microarray screen, line development and data analysis, participated ... culture and incubated in a bacterial shaker for h at 37°C before addition of IPTG to a final concentration of mM and an additional shaking for h at 37°C The induced bacteria were pelleted after...

Ngày tải lên: 12/08/2014, 04:20

9 751 0
A systematic approach for preferential crystallization   thermodynamics, kinetics, optimal operation and in situ monitoring

A systematic approach for preferential crystallization thermodynamics, kinetics, optimal operation and in situ monitoring

... synthesis and separation of racemates For most natural chiral substances, probably the easiest and cheapest way to obtain them as pure enantiomers is a classical extraction, because in nature often ... always in pairs The importance of separating a racemic mixture (a mixture containing an equal amount of a pair of enantiomers) has been emphasised by many authors (e.g Sheldon, 1993; Agranat and ... the laboratory-scale, against the totality of examples of the manufacture of optically active materials, at the industrial level, asymmetric syntheses are still relatively scarce Hence, alternatives...

Ngày tải lên: 14/09/2015, 18:18

307 350 0
Báo cáo hóa học: "A Systematic Approach to Modified BCJR MAP Algorithms for Convolutional Codes" ppt

Báo cáo hóa học: "A Systematic Approach to Modified BCJR MAP Algorithms for Convolutional Codes" ppt

... Intrinsix Canada, and a Research Consultant for Calian Corporation Currently, he works with Defence R & D Canada – Ottawa (DRDC Ottawa) His more recent research has focused on FFT filter-bank-based ... BCJR MAP algorithm for recursive systematic convolutional codes We can further simplify and reformulate the BCJR MAP algorithm for a binary rate 1/n recursive systematic convolutional code In fact, ... Communications Research Laboratory of McMaster University as a Postdoctoral Fellow Since September 1997, he has been working in Ottawa, Canada He was a Research Scientist at Telexis Corporation and...

Ngày tải lên: 22/06/2014, 23:20

15 411 0
a decentralized approach for implementing identity management in cloud computing

a decentralized approach for implementing identity management in cloud computing

... a hybrid misuse-anomaly detection approach to take advantage of anomaly detection’s ability to detect new attacks, but without the approach s accompanying high rate of false positives There are ... for IdM, Privacy and Identity Management for Europe (PRIME), Windows CardSpace, and OpenID Also they propose an entity-centric approach for IdM in the cloud that based on active bundles and anonymous ... anomaly behavior or not As demonstrated in [11], a basic assumption of anomaly detection is that attacks differ from normal behavior But the definition of what’s normal and what’s abnormal is ambiguous...

Ngày tải lên: 31/07/2013, 09:43

7 590 0
Tài liệu Focusing Resources on Effective School Health: A FRESH Approach for Achieving Education for All doc

Tài liệu Focusing Resources on Effective School Health: A FRESH Approach for Achieving Education for All doc

... planners, administrators and teachers, at the local as well as national level, can participate in and benefit from this exchange 11 Systematically monitor progress towards EFA goals and strategies at ... community, and take advantage of a skilled workforce (teachers and administrators) that is already engaged with individual and organisational partners in the local community As students become healthier, ... the Dakar Framework for Action during the World Education Forum (Dakar, 2000) are revitalising efforts to achieve Education for All In developing National Action Plans to achieve the goals and...

Ngày tải lên: 14/02/2014, 09:20

30 420 0
Tài liệu Design for Sustainability a practical approach for Developing Economies doc

Tài liệu Design for Sustainability a practical approach for Developing Economies doc

... Ethiopia Mr B.S Samarasiri, Moratuwa University, Sri Lanka Prof Dr John Turyagyanda, Makerere University, Uganda Dr Sonia Valdivia, UNEP DTIE, France Design and lay-out Ms Ana Mestre and Ms Gra a Campelo, ... Austria Mr Samantha Kumarasena, NCPC, Sri Lanka Mr Nguyen Hong Long, NCPC,Vietnam Ms Sophie Loran, UNEP DTIE, France Dr Diego Masera, UNEP Regional Office for Latin America and the Carribbean, ... spread as seen in the number of manuals and sectorspecific supporting materials that are available in many languages As a result, and based on experience, Ecodesign has evolved to encompass broader...

Ngày tải lên: 21/02/2014, 05:20

128 514 0
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

... localization of cathepsin E and cathepsin D in human gastric cells and various rat cells J Biochem (Tokyo) 110, 956–964 Tsukuba T, Hori H, Azuma T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi ... Tsukuba T, Yamamoto S, Yanagawa M, Okamoto K, Okamoto Y, Nakayama KI, Kadowaki T & Yamamoto K (2006) Cathepsin E-deficient mice show increased susceptibility to bacterial infection associated with ... Hayakumo T & Nakajima M (1996) Expression of cathepsin E in pancreas: a possible tumor marker for pancreas, a preliminary report Int J Cancer 67, 492–497 22 Uno K, Azuma T, Nakajima M, Yasuda...

Ngày tải lên: 07/03/2014, 09:20

12 645 0
Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc

Working PaPer SerieS no 1150 / January 2010: Do bank loanS anD creDit StanDarDS have an effect on outPut? a Panel aPProach for the euro area doc

... 8765 Bank of Albania, Sheshi “Skënderbej”, No.1 Tirana, Albania; e-mail: kadareja@yahoo.com © European Central Bank, 2010 Address Kaiserstrasse 29 60311 Frankfurt am Main, Germany Postal address ... N G PA P E R S E R I E S N O 115 / J A N U A RY 2010 DO BANK LOANS AND CREDIT STANDARDS HAVE AN EFFECT ON OUTPUT? A PANEL APPROACH FOR THE EURO AREA by Lorenzo Cappiello 2, Arjan Kadareja 3, ... Gambacorta, L and Marqués-Ibañez, D (2008), "Securitisation and the bank lending channel", European Economic Review (forthcoming) [3] Altunbas, Y., Gambacorta, L and Marqués-Ibañex (2009), "Bank...

Ngày tải lên: 15/03/2014, 10:20

30 911 0
ENVIRONMENTAL INDICATORS: A SYSTEMATIC APPROACH TO MEASURING AND REPORTING ON ENVIRONMENTAL POLICY PERFORMANCE IN THE CONTEXT OF SUSTAINABLE DEVELOPMENT pot

ENVIRONMENTAL INDICATORS: A SYSTEMATIC APPROACH TO MEASURING AND REPORTING ON ENVIRONMENTAL POLICY PERFORMANCE IN THE CONTEXT OF SUSTAINABLE DEVELOPMENT pot

... themselves may overlap (Resilience and stability, for instance, are similar.) The approach has been applied in an illustrative way to calculate an overall index for Costa Rica over a period of years ... Canada O t t a w a Ontario KIA 0H3 Commonwealth Scientific and Industrial Research Organization Aspendalc, Vicloria Australia Environment Canada - Atmospheric Environment Service - Conservation ... Senegal, the Gambia, and Belize Richard Woodward collaborated on a natural resource accounting study in Costa Rica for WRI's Program in Economics and Population and has also worked as a consultant to...

Ngày tải lên: 15/03/2014, 16:20

58 699 0
A Conceptual Approach for Cannibalism Between Goods pot

A Conceptual Approach for Cannibalism Between Goods pot

... estudo exploratório dos fatores de marketing que contribuem para a sua ocorrência em indústrias alimentícias paulistanas (Dissertation: Master in Administração) Mackenzie, São Paulo (in Portuguese) ... greater risk the last one Currently, presumed private label brands account for a significant share of sales of retailers, particularly in the area of food The growth in size and share of own brands ... organizations that can cause cannibalism without benefits These instances related to top management decisions or the management practices of their products that include: a) strong top management...

Ngày tải lên: 16/03/2014, 11:20

5 366 0
Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

Báo cáo khoa học: The competitor-introduced Gc recruitment system, a new approach for screening affinity-enhanced proteins doc

... and pLMZ-K3 5A- H using 50-nucleotide primers containing a region homologous to that directly upstream of PHOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG GCCG-3¢ and ... The fragments encoding Z variants were amplified from pUMZ-WT and pUMZ-K3 5A [7] using primers 5¢-TTTTGTCGACATGGCGCAACACGA TGAAGCCGTAGACAAC-3¢ and 5¢-AAAAGGATCCTT ATTTCGGCGCCTGAGCAT-3¢, and inserted ... DNA using primers 5¢-AAAAGCGGCCGCTTAAAGCAAGGGTAA ATT-3¢ and 5¢-TTTTGAGCTCATCTTTCAAATAGAGC CTGG -3¢, and inserted into the NotI–SacI site of pLMZ -WT and pLMZ-K3 5A, yielding plasmids pLMZ-WT-H and...

Ngày tải lên: 22/03/2014, 21:20

9 356 0
Báo cáo khoa học: "A Clustering Approach for the Nearly Unsupervised Recognition of Nonliteral Language" pdf

Báo cáo khoa học: "A Clustering Approach for the Nearly Unsupervised Recognition of Nonliteral Language" pdf

... the average of literal and nonliteral precision; similarly for average recall For overall performance, we take the f-score of average precision and average recall We calculated two baselines for ... the case of a larger scale annotation effort, having the person leading the effort provide one or two examples of literal and nonliteral usages for each target verb to each annotator would almost ... feature lists SuperTags (Bangalore & Joshi, 1999) encode a great deal of syntactic information in a single tag (each tag is an elementary tree from the XTAG English Tree Adjoining Grammar) In addition...

Ngày tải lên: 24/03/2014, 03:20

8 447 0
a systematic approach to solving chemistry problems

a systematic approach to solving chemistry problems

... precise and accurate Accuracy Refers to how close a measurement is to the real value Systematic error Values that are either all higher or all lower than the actual value Random Error In the absence ... absence of systematic error, some values that are higher and some that are lower than the actual value 25 26 Precision and accuracy in the laboratory Figure 1.16 continued random error systematic error ... significant figures are retained and to 5.4 if two significant figures are retained For addition and subtraction The answer has the same number of decimal places as there are in the measurement with...

Ngày tải lên: 02/06/2014, 09:22

5 258 0
báo cáo hóa học:" A systematic approach to biomarker discovery; Preamble to "the iSBTc-FDA taskforce on immunotherapy biomarkers"" docx

báo cáo hóa học:" A systematic approach to biomarker discovery; Preamble to "the iSBTc-FDA taskforce on immunotherapy biomarkers"" docx

... focus particular attention on assay validation but rather on biomarker validation Data exchange Data collection and data exchange is becoming extremely burdensome: a whole genome SNP array from Affymetrix ... collects all high-density data for the intramural program Similarly, data analysis could be centralized as several inter-institutional cooperative groups are already doing for low density data handling ... recommendations for assay parameters, coefficient of variation (CV) and data analysis to report in publications This should also include defining the analytical variation of the assay as well as determining...

Ngày tải lên: 18/06/2014, 15:20

10 508 0
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

... 85(3):221-228 Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients ... human bone marrow Proc Natl Acad Sci USA 2000, 97(7):3213-3218 Kawada H, Fujita J, Kinjo K, Matsuzaki Y, Tsuma M, Miyatake H, Muguruma Y, Tsuboi K, Itabashi Y, Ikeda Y, Ogawa S, Okano H, Hotta ... Bossolasco P, Deliliers GL: Differentiation and expansion of endothelial cells from human bone marrow CD133(+) cells Br J Haematol 2001, 115(1):186-194 Asahara T, Masuda H, Takahashi T, Kalka C, Pastore...

Ngày tải lên: 18/06/2014, 15:20

9 775 0
Báo cáo hóa học: " Exploring the bases for a mixed reality stroke rehabilitation system, Part I: A unified approach for representing action, quantitative evaluation, and interactive feedback" ppt

Báo cáo hóa học: " Exploring the bases for a mixed reality stroke rehabilitation system, Part I: A unified approach for representing action, quantitative evaluation, and interactive feedback" ppt

... of an Adaptive Mixed Reality Rehabilitation (AMRR) system for a reach and grasp action Preliminary data from a study employing the AMRR system has demonstrated the system’s ability to facilitate ... of customizable approaches to stroke rehabilitation Interactive rehabilitation also demands detailed, quantitative, real-time evaluation to reveal to the participant the state of his action network ... form the basis for quantifiable, adaptive, manageable re-learning of the relationships among action goal, activity and body functions within interactive stroke rehabilitation For this abstraction...

Ngày tải lên: 19/06/2014, 08:20

15 608 0
Báo cáo hóa học: "Research Article A Decentralized Approach for Nonlinear Prediction of Time Series Data in Sensor Networks" pptx

Báo cáo hóa học: "Research Article A Decentralized Approach for Nonlinear Prediction of Time Series Data in Sensor Networks" pptx

... (24) for a better trade-off between convergence speed and steady-state performance Note also that regularization is usually unnecessary in (21) and (24) for adequate values of ν (Regularization would ... other hand, a small value for ν will result in a large model order This will lead to a small approximation error, at the price of high computational load for updating the model at each sensor, and ... however, each sensor must know the locations of the other sensors This unfortunately imposes a substantial demand for both storage and computational time, as most practical applications require a large...

Ngày tải lên: 21/06/2014, 17:20

12 532 0
Báo cáo hóa học: " Research Article A Practical Approach for Simultaneous Estimation of Light Source Position, Scene Structure, and Blind Restoration Using Photometric Observations" pot

Báo cáo hóa học: " Research Article A Practical Approach for Simultaneous Estimation of Light Source Position, Scene Structure, and Blind Restoration Using Photometric Observations" pot

... surface gradients and the albedo and also perform blind image restoration The surface gradients and the albedo are modeled as separate Markov random fields (MRFs), and a suitable regularization scheme ... reached It may be mentioned here that p, q are all matrices γm and τm are real values corresponding to a particular source position and σ is also a real value As already mentioned, we use the albedo ... labels for estimating the same was chosen as 10 Figures 7 (a) and S Sharma and ManjunathV Joshi (a) (b) (c) Figure 8: Depth map for vase (a) ground truth and obtained using (b) LS approach on...

Ngày tải lên: 21/06/2014, 22:20

12 379 0
Báo cáo hóa học: " Research Article A Systematic Approach to Design Low-Power Video Codec Cores" doc

Báo cáo hóa học: " Research Article A Systematic Approach to Design Low-Power Video Codec Cores" doc

... Full Op mode Addr Data in Data out Block Block ··· Block n − Data Data Data Data Data Data Data Data ··· ··· ··· ··· Data k − Data k − Data k − Data k − Empty Op mode Addr Data in Data out Op mode: ... Yokohama, Japan, January 2006 F Haim, M Sen, D.-I Ko, S S Bhattacharyya, and W Wolf, “Mapping multimedia applications onto configurable hardware with parameterized cyclo-static dataflow graphs,” ... coding Add headers and compose the bitstream r/w Addr Data in Data out r/w Addr Data in Data out Memory Data in Active Shadow (a) Shared memory Valid Data out Update (b) Configuration registers...

Ngày tải lên: 22/06/2014, 19:20

14 441 0
w