a synthetic peptides and b proteus haemolysin protein

... 0.025 analysis analysis analysis analysis analysis Cross-linked Interfacial Peptides < /b> >50 Non-Peptide Based Inhibitors Ursolic acid Didemnaketal A < /b> penta-ester derivative a < /b> Gel-filtration; protein ... p66 and < /b> p51 [58] Enhanced homodimerization of the RT p66 subunits by efavirenz has also been observed in both the Y2H assay and < /b> in in vitro binding assays (G Tachedjian, unpublished observations) ... (and < /b> virtually all other designated protein protein interactions) has been reported [27] Briefly, this strategy takes advantage of k-bacteriophage repressor protein (cI) that binds to its operator...

Ngày tải lên: 08/03/2014, 09:20

... used, with ovalbumin (A;< /b> 43 kDa), chymotrypsinogen A < /b> (B; 25 kDa) and < /b> ribonuclease A < /b> (C; 13.7 kDa) as molecular standards for the mass calibration (Bottom) Sedimentation equilibrium distribution of ... datasets, the absorbance of the depleted area at a < /b> final speed of 40 000 r.p.m provided an experimental value for the baseline offset The data were analysed with the ORIGIN XL -A/< /b> XL1 package (Beckman) ... Tobacco etch virus protease cleavage was then obtained by incubating the protein overnight at °C Further purification from glutathione S-transferase was carried out by gel filtration chromatography...

Ngày tải lên: 23/03/2014, 12:20

... yeast-based models have the advantage that they are less complex and < /b> better genetically defined An additional benefit is the ease and < /b> rapidity with which yeast cells can be manipulated and < /b> grown, making ... with an antia-syn rabbit polyclonal antibodies directed against the C-terminus (Sigma) Alkaline phosphatase-conjugated (Santa-Cruz Biotech, Santa Cruz, CA) or horseradish peroxidase-conjugated (Bio-Rad, ... 44284–44296 Hasegawa T, Matsuzaki M, Takeda A,< /b> Kikuchi A,< /b> Akita H, Perry G, Smith MA & Itoyama Y (2004) Accelerated alpha-synuclein aggregation after differentiation of SH-SY5Y neuroblastoma cells Brain...

Ngày tải lên: 23/03/2014, 13:20

... experimentalists are encouraged to submit their data for storage and < /b> display Results Handling and < /b> storage of phosphosite data The mtcPTM database contains data retrieved from literature, protein annotations, ... annotations, and < /b> other databases In the future, the database will also display phosphorylation sites that have been mapped as part of the MitoCheck project The mtcPTM database therefore handles quite ... differential phosphorylation in mitosis However, its general design is readily applicable to any data, regardless of experimental source The database is publicly available online, and < /b> experimentalists...

Ngày tải lên: 14/08/2014, 07:21

... 5Â-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â) The PCR product was puried, treated with T4 exonuclease to create vector-compatible overhangs and < /b> annealed to a < /b> prepared ... amyloliquefaciens, in that both proteins bind well to both a-< /b> and < /b> b- chitin As noted above, ChbB is the closest homologue of LlCBP3 3A < /b> and < /b> the two proteins share sequence characteristics that separate ... reach binding equilibrium The extent and < /b> specicity of LlCBP3 3A < /b> binding was analysed by SDS-PAGE (Fig 5A,< /b> B) The amount of LlCBP3 3A < /b> bound was also analysed by determining the protein concentrations...

Ngày tải lên: 18/02/2014, 08:20

... 107 2850 AACGAGgtaggc ATCAAGgtaaga ACACAGgtttga GCAAAGgtaatg GAGAAAgtaagt CTTCAGgtaatt ACCACGgtaggc TTGCAAgtatgc ACCAGGgtaagt AACAAGgtaaga TACCAGgtatga TTGATGgtgaga CAGAAGgtaaca GGAAGGgtgagt 35209 ... 70034 ttacagGTTTCT ctgcagGCTGTG ttttagATTCAA ttgcagGTCTGT ttatagGTTGCT tttcagGATGTG aaccagGTTATT tttcagACCCTA atttagCTTCAT ctttagGGGAAA atctagCATTGA atgtagGCAAAA aatcagGATGTT tttcagCTTTGA gene ... 5¢-GG AATTCAGTGGAAAAACTTTACAT-3¢ for XN73, and < /b> the primers 5¢-GGAATTCATGCCGACCACAACCGTT TTAAG-3¢ and < /b> 5¢-GGAGACAGTGACAAGTTATCTA GTGCT-3¢ for XPR70 PCR products were resolved on a < /b> 1.5% (w/v) agarose...

Ngày tải lên: 08/03/2014, 08:20

... that the active site of the enzyme can strictly distinguish between an a-< /b> amino and < /b> a < /b> b- amino group of lysine Other b- amino acids such as b- alanine or b- aminobutyric acid, c-aminobutyric acid and < /b> ... synthesized by an NRPS-like system in a < /b> mechanism that uses NspA, a < /b> stand-alone b- lysine adenylating enzyme (A-< /b> domain) and < /b> NspB, a < /b> b- lysine binding protein consisting of a < /b> PCPdomain and < /b> a < /b> domain with ... see Materials and < /b> methods) was incubated with NpsA, radioactive b- lysine and < /b> ATP The reaction mixtures were incubated at 28 °C for 30 mL 5% trichloroacetic acid was added and < /b> precipitated protein...

Ngày tải lên: 17/03/2014, 17:20

... (Hsp9 0a,< /b> forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp9 0b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... Hsp90 clients and < /b> Hsp90 inhibitor sensitivity in such strains; analysis that showed that many mammalian clients are able to be activated by both Hsp9 0a < /b> and < /b> Hsp9 0b Whether Hsp9 0a < /b> or Hsp9 0b is expressed ... staining revealed almost instant loss of any actin organization following Hsp90 inhibitor treatment; data not shown) After h, many of these cells displayed an apparent arrest of DNA and < /b> vacuolar...

Ngày tải lên: 23/03/2014, 07:20

... epithelial cell layer by pIgR 2) They may have been secreted by B cells located in the lamina propria of airways As such locally produced Abs, particularly J-chain associated IgA and < /b> IgM, can be expected ... They may be serum Abs that transudated into extravascular spaces of airway tissues and,< /b> in the case of IgG, transudated further into the airway lumen or, in the case of IgA and < /b> IgM, became transported ... e-max ELISA reader and < /b> analyzed with Softmax Pro software (both Molecular Devices, Sunnyvale, CA) Statistical analyses Prism software [64] was used for plotting and < /b> statistical analysis of data...

Ngày tải lên: 18/06/2014, 18:20

... alkaloids are the Stemona plants, also known as Roxburghia They are found in South Asia, Malaysia and < /b> North Australia and < /b> are classified as subshrubs, or twining herbs, with thick and < /b> tuberous roots.5 ... more that I could ask for xviii LIST OF ABBREVIATIONS Ac………………… acyl Acac…………………acetylacetonate AIB………………….α-aminoisobutyric acid AIBN……………… 2,2’-azobis(2-methylpropionitrile) ATR…………………Attenuated ... stay grounded and < /b> been a < /b> source of unwavering support over the years In particular, I want to thank my cousins Alanna and < /b> Camilla Mingay I think that I found the best travel companions ever and...

Ngày tải lên: 23/08/2015, 17:30

... deprotection is carried out in the presence of an acylating agent, a < /b> transacylation can take place between the pseudometallic carbamate and < /b> the acylating agent leading a < /b> new amide bond Hence, a < /b> tandem deprotection–coupling ... 1043 Auckland New Zealand Narasimhamurthy Narendra Bangalore University Department of Studies in Chemistry Central College Campus Dr B. R Ambedkar Veedhi Bangalore 560001 Karnataka India Daniel Sejer ... 72 TEA, H2O/dioxane, 2h O N H COOH 70 Figure 1.35 Preparation of Na-Boc-amino acids cially available as well as stable for long duration Acidification of the alkali salt of Bocamino acids (and...

Ngày tải lên: 02/12/2016, 12:08

... father a < /b> than b as c but d and < /b> > a < /b> 48 I am teacher a < /b> the b a < /b> c an d no article > b 49 My uncle is good engineer a < /b> the b a < /b> c an d no article > b 50 That is eraser a < /b> the b a < /b> c an d no article ... the b a < /b> c an d no article > b 55 That is a < /b> bag It is on table a < /b> the b a < /b> c an d no article > a < /b> 56 We are in same class a < /b> the b a < /b> c an d no article > a < /b> 57 Your book is the desk a < /b> at b over ... pounds from a < /b> bank a < /b> crime b criminal c criminally d criminality > b 178 your own business can cause a < /b> lot of financial worries a < /b> Manage b Managing c Manager d Manageable > b 179 The surgeons...

Ngày tải lên: 05/11/2012, 09:18

... ns Romania Poland India France Germany Portugal Brazil Hong Kong Ukraine Other USSR/Russia Japan China Vietnam Nigeria Colombia Thailand Nicaragua Peru Ecuador Trinidad and < /b> Tobago Guyana/British ... Nigeria Ireland Haiti Egypt/United Arab Rep Iraq Honduras Nicaragua South Africa Portugal Turkey France Thailand Trinidad and < /b> Tobago Guyana/British Guiana Syria Jordan All other foreign-born U.S.-born ... Mexico India Korea Cuba China Vietnam Canada Iran Philippines Poland Italy Colombia Taiwan Germany El Salvador Pakistan England Greece Brazil Israel/Palestine Dominican Republic Jamaica Other USSR/Russia...

Ngày tải lên: 18/02/2014, 00:20

... Eghbali-Webb, M (2001) Release of pro- and < /b> antiangiogenic factors by human cardiac fibroblasts Biochim Biophys Acta 1538, 273–282 10 Balasubramanian, S., Ramakrishnan, S., Charboneau, R., Wang, J., Barke, ... dbpB (also known as YB-1, MSY-1, chkYB- 1b, EF 1A,< /b> p50 and < /b> FRGY1) and < /b> dbpA (MSY4, chkYB-2 and < /b> YB2/RYBa) DbpB and < /b> dbpA CSD proteins are ubiquitously expressed and < /b> are highly conserved across species ... dbpA (also called MSY-4, chkYB-2 and < /b> YB2/RYBa) [22–25,29] Both CSD and < /b> PTB proteins have been shown to functionally interact with a < /b> number of partner proteins e.g [23,43] but the dbpA or dbpB/YB-1...

Ngày tải lên: 19/02/2014, 12:20

... Nevertheless, both proteins present an essentially identical ice-binding face that is considerably better at Fig A < /b> comparison of sbwAFP and < /b> TmAFP structures (A)< /b> An overlap of smoothed Ca traces obtained by ... of sbwAFP and < /b> TmAFP The structure of sbwAFP has been determined by X-ray ˚ crystallography to 2.5 A < /b> and < /b> by NMR at both 30 °C and < /b> °C [34,37,38] Both techniques show that the fold is a < /b> lefthanded, ... faces of the protein perpendicular to the helical axis The strands from ˚ the b- sheets are spaced 4.8 A < /b> apart and < /b> are relatively flat and < /b> untwisted compared to b- sheets found in non b- helical proteins...

Ngày tải lên: 19/02/2014, 16:20

... Mutagenic antisense oligonucleotides for MCAD842GfiC (5¢-GAT AAAACCACACCTGTAGTAGCTG-3¢) and < /b> MCAD 116 5A< /b> G (5¢-CCTGTAGAAAGACTAATGAGGGATG CC-3¢) (mutagenic substitutions are shown in bold), and < /b> ... ferricenium assay after a < /b> 10-min incubation at the temperature indicated (error bars ¼ standard deviation of the mean), and < /b> (B) the amount of tetramer present, as determined by western blot analysis ... impact greatly on the catalytic activity, as the kcat and < /b> the ETF interaction are relatively unaffected This mutation seems to affect mainly the initial folding and < /b> stability of the tetramer, and...

Ngày tải lên: 20/02/2014, 02:21

... pair was X133 (5¢ TCC AgAAAAgATCgCAA gATg 3¢) [35] and < /b> X300 (5¢ AgAgC CAAgCTTTTACT ATCggTT 3¢) The PCR products were fractionated using a < /b> low melting point agarose gel (1.2%) The DNA band was ... equipped with an analogue-to-digital interface board (DT2821, Data Translation, Marlboro, USA) Endplate potentials and < /b> miniature endplate potentials were analysed individually for amplitude and < /b> time ... three major peaks (a,< /b> b and < /b> c) Electrospray mass analyses revealed that peak a < /b> was a < /b> truncated form of sWntx-5 terminated at Pro33 (3749.6 Da), peak b contained peptides < /b> ranging from Ó FEBS 2002...

Ngày tải lên: 21/02/2014, 03:20

... 45-kDa Tm-mas A < /b> secondary antibody (alkaline phosphatase-conjugated anti-rabbit IgG, Bio-Rad) was used at a < /b> dilution of : 1000 Phage DNA was isolated from phage lysates by using a < /b> lambda DNA preparation ... raised against the Tenebrio 79-kDa pro-PO and < /b> 45-kDa Tm-mas (A)< /b> The 79-kDa and < /b> 76-kDa bars indicate Tenebrio pro-PO and < /b> PO, respectively (B) The 55-kDa and < /b> 45-kDa bars indicate the zymogen form and < /b> ... SDS/PAGE and < /b> then immunoblotting with the a< /b> nity-purified antibody raised against the 45-kDa Tm-mas solution was preincubated with p-NPGB and < /b> p-APMSF, and < /b> then calcium and < /b> b- 1,3-glucan were added...

Ngày tải lên: 21/02/2014, 03:20

... BSA and < /b> a < /b> protease inhibitor cocktail) Bound proteins were recovered by boiling beads in Laemmli sample buffer 2· (Sigma) and < /b> analysed by western blotting Ubiquitination assay HeLa, HEK 293 and < /b> ... primarily at the plasma membrane, BAF6 0b ubiquitination is controlled by Rac and < /b> Unkempt BAF6 0b, as well as BAF6 0a < /b> and < /b> BAF60c, were found, as expected, entirely localized to the nuclear compartment ... A < /b> Fig Subcellular localization of BAF60 and < /b> Unkempt proteins (A)< /b> Nuclear localization of BAF60 proteins HeLa cells were transfected with FLAG-BAF6 0a,< /b> b or c, and < /b> FLAG immunofluorescence was carried...

Ngày tải lên: 06/03/2014, 09:22