a summary of kinetic data of different types of combustible materials
Pyrolysis and combustion processes of combustible materials under external heat flux
Ngày tải lên :
09/09/2015, 11:28
... capable of simulating fire behaviors of different types of combustible materials Because of various fire behaviors of these four types of combustible materials, it is challenging and significant ... input 208 Appendix A: A summary of kinetic data of different types of combustible materials 258 Appendix B: A summary of considerations in previous one-dimensional models for wood ... Limitation and future work 228 References 230 Appendix A: A summary of kinetic data of different types of combustible materials 258 Appendix B: A summary of considerations...
- 321
- 496
- 0
Measurements and Mitigation of Peer-to-Peer-based Botnets: A Case Study on Storm Worm ppt
Ngày tải lên :
23/03/2014, 13:20
... on average) The first Storm-related message we are aware of was received on December 29, 2006: It contained best wishes for the year 2007 and as an attachment a copy of the Storm binary An analysis ... contacts and are organized as an unbalanced routing tree Each contact consists of the node’s DHT ID, IP address, and UDP port A peer a stores only a few contacts to peers that are far away in ... computes the key The drawback of this approach is that the attacker can easily change f and then we need to analyze the binary again, thus we are always one step Figure 1: Keys generated by Storm in...
- 9
- 560
- 0
Báo cáo sinh học: "This peer-reviewed article was published" docx
Ngày tải lên :
18/06/2014, 22:20
... fundamental properties of the nitride-based materials, one can get more insight into the applications of these materials Semiconductor nanowires have attracted a lot of attention due to the large ... ratio [16] Furthermore, in the applications of GaN materials, the defects of GaN will affect the electrical and optical properties of the GaN-based devices greatly and thus affect the performance ... reveals that the surface state is due to the tip of the GaN nanorod Figure 3a shows the FE-SEM image of an isolated GaN nanorod placed on a gold-coated Si substrate The length of the isolated GaN...
- 15
- 99
- 0
Báo cáo sinh học: " This peer-reviewed article was published immediately upon acceptance. It can be downloaded, printed " ppt
Ngày tải lên :
18/06/2014, 22:20
... Critical aspects of substrate nanopatterning for the ordered growth of GaN nanocolumns Francesca Barbagini*†1, Ana Bengoechea-Encabo†1, Steven Albert†1, Javier Martinez†1, Miguel Angel Sanchez Garc a 1, ... of the initial patterned mask, meaning that the vertical growth rate was much higher than the lateral one After 30 of growth, all the GaN NCs have a constant height of about 200 nm and show a ... 309:113-120 Fernandéz-Garrido S, Grandal J, Calleja E, Sánchez-Garc a MA, López-Romero D: A growth diagram for plasma-assisted molecular beam epitaxy of GaN nanocolumns on Si(111) J Appl Phys 2009,...
- 16
- 252
- 0
Báo cáo y học: "Comparative Hepatology: A journal for all hepatologists with immediate Open Access to quality peer-reviewed research" pptx
Ngày tải lên :
13/08/2014, 13:20
... also realized the importance of Open Access publishing and have specified that their grants may be used directly to pay APCs [7] A glance at our first year of publication Launched in late August ... Open Access to Comparative Hepatology articles Authors are asked to pay the equivalent to US$525 if their article is accepted for publication No charge is made for articles that are rejected after ... [5], the National Library of the Netherlands' digital archive of all electronic publications Article-processing charges and waivers Article-processing charges (APCs) are needed to allow continued...
- 3
- 182
- 0
Báo cáo y học: "Inappropriate use of the title ''''chiropractor'''' and term ''''chiropractic manipulation'''' in the peer-reviewed biomedical literature" ppsx
Ngày tải lên :
13/08/2014, 14:20
... education and training against a set of educational Standards It is the only chiropractic educational accreditation agency serving Europe that is a member of the Council on Chiropractic Education ... Education [23] ECCE Standards specify that the duration of a chiropractic programme last for at least five full-time academic years and are based on the following definition and description of a ... 'chiropractor' and/or term 'chiropractic manipulation' Competing interests The author declares that he is a practicing chiropractor (part-time), an Associate Governor of the Australian Spinal Research...
- 7
- 250
- 0
Báo cáo y học: "Peer-reviewed, high quality, worldwide information on all topics relevant to child and adolescent mental health" ppt
Ngày tải lên :
13/08/2014, 18:21
... international collaboration of mental health professionals Child and Adolescent Psychiatry and Mental Health is committed to: a) Publishing high quality scientific reports of new data that enhance ... launching this new journal, we strongly feel encouraged by the International Association for Child and Adolescent Psychiatry and Allied Professions (IACAPAP)[2], an organization that is similarly ... journals is limited In return, a broader and more diverse audience is likely to generate a greater variety of contributions Because of the impact of social and cultural factors on the approach...
- 3
- 204
- 0
Báo cáo y học: "Electronic patient record use during ward rounds: a qualitative study of interaction between medical staff"
Ngày tải lên :
25/10/2012, 10:31
... Intensive care unit The ICU, consisting of 25 critical care beds, is part of a specialist hospital that concentrates on all aspects of adult cardiothoracic care Approximately 70% of admissions are patients ... ward round All other screens – that is, those giving detailed data on particular aspects of a patient's condition and treatment – are accessible via tabs displayed across the top of the summary ... seen after the ward-round team became aware of the lack of interaction when using the EPR – a change of formation to allow focus on the conversation rather than the data, as described above, and...
- 8
- 503
- 0
A kinetic study of resorcinol-enhanced hydroxyl radical generation during ozonation with a power law type equation
Ngày tải lên :
05/09/2013, 09:38
... radical generation 1.5-fold that of phenol itself Power law type rate equations are usually adopted to correlate the experimental data in laboratory-scale and pilot-plant scale reactors, and even ... Hakoda M., Shimbara S., Nagaoka H., Chung Y and Hamada A (1994) Active oxygen species generated during chlorination and ozonation Water Sci Technol., 30, 91-99 Utsumi H., Han S.K and Ichikawa ... (Spin Trapping) Photolysis of organolead, -tin, and mercury Compounds J Am Chem Soc., 91, 4481-4490 Morioka T., Motoyama N., Hoshikawa H., Murakami A. , Okada M and Moniwa T (1993) Kinetic analysis...
- 7
- 569
- 0
A CFD study of hygro-thermal stresses distribution in tubular-shaped ambient air-breathing PEM micro fuel cell during regular cell operation
Ngày tải lên :
05/09/2013, 14:58
... several ways such as chemical degradation of the ionomer membrane or mechanical failure in the PEM that results in gradual reduction of ionic conductivity, increase in the total cell resistance, and ... of voltage and loss of output power [7] Mechanical damage in the PEM can appear as through-the-thickness flaws or pinholes in the membrane, or delaminating between the polymer membrane and gas ... layers [8] An operating fuel cell has varying local conditions of temperature, humidity As a result of in the changes in temperature and moisture, the membrane, GDL and bipolar plates will all...
- 16
- 390
- 0
Experimental investigations and CFD study of temperature distribution during oscillating combustion in a crucible furnace
Ngày tải lên :
05/09/2013, 14:59
... deviation was found to be in control This is due to the fact that most of the radiation flux was available at this designated point and near the furnace wall Predictions of CFD temperatures are also ... International Journals and Conferences E-mail address: termarrow@yahoo.com J Narsaiah, working as Assistant Professor in PRRMEC, Shabad He has done his M.Tech in Industrial Engineering and Management ... validation of a gas-fired self-regenerative crucible furnace was presented by Francisco cadavid et al Turbulence, radiation and chemical reactions are simulated using the software Gambit V2 and Fluent...
- 14
- 590
- 1
A STUDY ON THE USE OF PEER TEACHING IN ESP CLASSES AT THE COLLEGE OF SCIENCE, VIETNAM NATIONAL UNIVERSITY HANOI
Ngày tải lên :
29/01/2014, 10:49
... collected data of the study was analyzed both quantitatively and qualitatively according to two facets: (1) the teachers and students’ perceptions of peerteaching; advantages and disadvantages of peer-teaching; ... disadvantage of peer teaching that annoyed surveyed teachers is that this teaching technique makes teachers and students have to work more than usual All of these make it clear that the preparation ... has been taught for many years at the 2nd stage with the duration of around 120 classes, each of which lasts 45 minutes The aim of this ESP course is to help students read and translate the materials...
- 40
- 903
- 3
Tài liệu Air pollution exposure during pregnancy and reduced birth size: a prospective birth cohort study in Valencia, Spain docx
Ngày tải lên :
17/02/2014, 22:20
... Public Health Conselleria de Sanitat, Avda Catalunya 21, 46020, Valencia, Spain 5Andalusian School of Public Health (EASP), Campus de la Cartuja s/n, Granada, Spain 6Department of Public Health, ... bivariate analysis to determine parental and pregnancy characteristics associated with birth outcomes We also examined individual NO2 levels and maternal and pregnancy characteristics Association ... developed the land use regression analysis, assisted with data analysis, and helped with data interpretation and manuscript preparation SL, AE, RR, ML, and MR contributed to data collection, provided...
- 11
- 529
- 0
Atmospheric volatile organic compound measurements during the Pittsburgh Air Quality Study: Results, interpretation, and quantification of primary and secondary contributions pot
Ngày tải lên :
05/03/2014, 21:20
... and A L Robinson (2002), Sources of atmospheric carbonaceous particulate matter in Pittsburgh, Pennsylvania, J Air Waste Manage., 52(6), 732 – 741 Cabada, J C., S Takahama, A Khlystov, S N Pandis, ... Rate: Summer Dataa,b High Ozone Daysc All Days Fraction of Total VOC LOH LOH, sÀ1 Fraction of Total VOC LOH LOH, sÀ1 Category Median IQRe Median IQRe Median IQRe Median IQRe Total Alkanesf Alkenes ... interval A trap for the removal of carbon dioxide and ozone (Ascarite II, Thomas Scientific) was placed downstream of the water trap in the Rt-Alumina/FID channel An ozone trap (KI-impregnated glass...
- 17
- 619
- 0
A study on how to make a good impression of English speaking during job interviews
Ngày tải lên :
18/03/2014, 10:15
... end up stammering away Instead, share what you know and what you are certain about Great 22 conservations are not unavoidably about world affairs An informed talk about gardening can make your ... with a partner, choral readings of the same passages Have students tape record their oral reading, listen to it, evaluate and then repeat Daily oral and silent reading practice of at least 20 ... language Almost all verbal communication is digital and practically all body language is analogue Spoken language and body language go mostly hand in hand When someone says something, information...
- 46
- 924
- 1
báo cáo sinh học:" Supervision of community peer counsellors for infant feeding in South Africa: an exploratory qualitative study" docx
Ngày tải lên :
18/06/2014, 17:20
... physical proximity to the research management team, this supervisor interacted with management more often telephonically Staff salaries and attrition The challenge of staff salaries and attrition ... for me and that made me to take a back seat, you find that there was a prioritising in the data collection So you find that there's importance over what the data collectors and it's a sense of emergency ... came about It helped a lot because they sat as a group not as individuals, they talked about the chal- Page of 10 lenges that they've met and how they can handle that situation in future (A) ...
- 10
- 336
- 0
báo cáo hóa học: " Evaluation of the reliability and validity of the Medical Outcomes Study sleep scale in patients with painful diabetic peripheral neuropathy during an international clinical trial" pot
Ngày tải lên :
18/06/2014, 19:20
... translations, backward translation, cognitive debriefings and international harmonization [27]; Australian, South African and UK English versions have undergone an adaptation from the original ... fact that as patients are being treated, most of the patients classified as stable are actually minimally improved It also suggests that pain and the other factors, taken individually, can not ... sleep impairment [15] The present study examines perceptions of sleep in an international clinical trial aimed at evaluating the efficacy and safety of the pregabalin, a treatment for pain relief...
- 12
- 553
- 0
Báo cáo sinh học: " HBx M130K and V131I (T-A) mutations in HBV genotype F during a follow-up study in chronic carriers" potx
Ngày tải lên :
19/06/2014, 08:20
... CAGGTTAAAGGTCTTTGTATTAGGAGGCTGTAGGCA 6604m_969CAGGTTAATGATCTTTGtatTAGGAGGctgTAGGCa 6516m_90-0 CAGGTTAAA TATTAGGAGGCTGTAGGCA 6541m_27-0 CAGGTtAAA TATTAGGAGGCTGTAGGCA 6290m_1232 CAGGTTAAA ... Investigaciones Científicas y Tecnológicas (National Council for Science Research and Technology) and Organización Panamericana de la Salud (Health Panamerican Organization) grant The authors thank all ... CAGGTTAAA TATTAGGAGGCTGTAGGCA 467h_969-0 CAGGttAAA TATTAGGAGGCTGTAGGCA Consensus CAGGTTAAATATTAGGAGGCTGTAGGCA SspI r e c o g n i t i o n s i t e stop codon responding to 1763–1770 nt of the complete...
- 10
- 438
- 0
Báo cáo hóa học: " Gait training with partial body weight support during overground walking for individuals with chronic stroke: a pilot study" ppt
Ngày tải lên :
19/06/2014, 08:20
... 0.001) Statistical analysis For all variables, data from three trials under each evaluation were averaged for each participant A one-way analysis of variance (ANOVA) was conducted, using evaluation ... conception and design of the study, gait training, acquisition of data, analysis and interpretation of data, and drafting the article CLPM was responsible for gait training, acquisition of data, analysis ... evaluation (before and after gait training) as a factor and mean walking speed as the dependent variable Two two-way ANOVAs and six multivariate analyses of variance (MANOVAs) were employed,...
- 8
- 284
- 1
báo cáo hóa học: "Using an electrohydraulic ankle foot orthosis to study modifications in feedforward control during locomotor adaptation to force fields applied in stance" potx
Ngày tải lên :
19/06/2014, 08:20
... during push-off at slow, moderate and high walking speeds [17], it can be seen that torque and power reserve are available at this phase of gait, and therefore that the lack of adaptation did not ... coordination and ankle joint dynamics using a different ankle exoskeleton that assists plantarflexion based on plantarflexor EMG signals They showed a gradual motor adaptation during push-off and ... indicates that velocity was similar to baseline A positive value indicates that velocity was larger than baseline and a negative value indicates a slowing down of the joint compared to baseline...
- 11
- 419
- 0