a suitable way to estimate gfp expression in situ
báo cáo khoa học: " Molecular characterisation and genetic mapping of candidate genes for qualitative disease resistance in perennial ryegrass (Lolium perenne L.)" doc
... 134.3 N /A N /A N /A N /A N /A N /A N /A N /A N /A N /A N /A N /A N /A N /A Information on SNP frequencies within F1(NA6 × AU6) biparental contigs, preliminary validation and positions on the parental maps of ... NA6-LG1- 34.7 N /A N /A N /A N /A N /A N /A NA6 – LG1- 151.6 N /A N /A N /A N /A AU6 – LG2- 57.4 N /A NA6 – LG2- 172.7 N /A N /A N /A N /A N /A N /A N /A AU6 – LG1- 74.1 NA6 – LG2- 166.6 N /A AU6 – LG5 – 65.1 NA6 ... N /A N /A 510 N /A N /A 510 N /A N /A N /A 162 86 N /A 30 24 36 134 26 22 35 141 77 15 119 45 96 0 0 0 0 1 0 0 3 N /A N /A N /A N /A N /A N /A N /A N /A N /A N /A N /A N /A LG2 – 32.5 N /A N /A N /A N /A N /A N /A N/A...
- 22
- 446
- 0
Báo cáo y học: "Validation and refinement of gene-regulatory pathways on a network of physical interactions" pps
... each expression coherence score Additional data files Expression profiling Additonal data is available with the online version of this paper Additional data file contains Tables S1-S4 and wiring ... Msn4 and Hap4 pathways and disambiguates the role of each pathway interaction as activating (Swi4 interactions) or repressing (Sok2 interactions) downstream genes (e) The Yap6 pathway hypothesis ... our approach may not identify regulatory pathways in which several transcription factors independently activate gene expression Applying knockouts in combination may prove fruitful in these cases...
- 10
- 259
- 0
Báo cáo y học: "he discovery, positioning and verification of a set of transcription-associated motifs in vertebrates" pps
... 5'-CTCTGTCAAGAAAGTGATGCCGTGAAA-3' Antisense 5'-GAATGTTCAGAAGAGCAGCCGAGGGAT-3' Sense 5'-CCAGGCCACGTTGTTATTTTGCTTCCGC-3' Antisense Deletion 5'-AAAATAACAACGTGGCCTGGCCAGAGCC-3' starting from the best scoring ... understood phenomena of cytosine methylation on CpG dinucleotides allows the methylated cytosine to mutate far faster than any other base pair in the genome, leading to a relative lack of CG dinucleotides ... CTCGCGAGA 14.6 4.13e-8 TTGGCT TATAAA 13.9 0.01 13.7 0.49 AAGATGGCGG TTTGTT 13.6 0.001 13.4 0.13 ATGCAAAT 13.3 1.0e-4 TAATTA 13.1 0.06 TTTAAG 13.1 0.5 CGCATGCG 13.1 1.1e-5 ATAAAT 12.6 0.02 TTTAAA...
- 14
- 295
- 0
báo cáo hóa học:" Cross-cultural validation and analysis of responsiveness of the QUALIOST®: QUAlity of Life questionnaire In OSTeoporosis" pptx
... Mean change measured between baseline and endpoint ES = (mean at endpoint – mean at baseline)/standard deviation of change patients had a fracture, they tended to have a positive mean change in ... reliable and valid tool to measure QoL in postmenopausal osteoporotic women Being available in several validated language versions, it is ready to be used in a variety of settings, including international ... score, indicating a decrease in QoL and patients without a fracture had a slight decrease in their scores, indicating a small improvement in their QoL ES for painful vertebral fractures ranged...
- 10
- 416
- 0
HIV INFECTION IN THE ERA OF HIGHLY ACTIVE ANTIRETROVIRAL TREATMENT AND SOME OF ITS ASSOCIATED COMPLICATIONS docx
... summary of the lipid lowering therapy in HIV infected people Rosuvastatin and atorvastatin have higher efficacy than pravastatin in decreasing LDL-c Due to partial metabolism of atorvastatin by ... effects on plasma levels of statins (atorvastatin, fluvastatin, lovastatin, pitavastatin, pravastatin, rosuvastatin, simvastatin), fibric acid derivatives (gemfibrozil, fenofibrate), digoxin, glipizide, ... theory, a study showed that atazanavir/ritonavir was associated with an increased in rosuvastatin levels This finding led the authors to conclude that the maximum rosuvastatin dose with atazanavir/ritonavir...
- 222
- 545
- 0
Báo cáo y học: "Perspectives and limitations of gene expression profiling in rheumatology: new molecular strategies" doc
... approach, 10 11 12 13 Suzuki A, Yamada R, Chang X, Tokuhiro S, Sawada T, Suzuki M, Nagasaki M, Nakayama-Hamada M, Kawaida R, Ono M, et al.: Functional haplotypes of PADI4, encoding citrullinating ... candidates, functional mechanisms and diagnostic patterns Comparing autoimmune diseases with the response to influenza vaccination in healthy donors, Maas and colleagues investigated peripheral ... processes As in routine laboratory analysis, standards and ranges need to be defined to distinguish Available online http://arthritis-research.com/content/6/4/140 Figure data sharing and collectively...
- 7
- 382
- 0
Báo cáo y học: "MethMarker: user-friendly design and optimization of gene-specific DNA methylation assays" pptx
... methylation biomarkers are tested and confirmed in clinical trials has remained disappointingly low While it is inevitable that a large percentage of candidate biomarkers will fail in clinical trials ... the optimal combinations of DNA methylation assays for each method, again ranked by their correlation with the overall DNA methylation level in each of the training samples (Additional data file ... overall DNA methylation level in each of the training samples (Additional data file 1) A Pearson correlation coefficient above 0.9 and a Spearman correlation coefficient above 0.8 indicate a highly...
- 10
- 443
- 0
báo cáo khoa học: " Identification, utilisation and mapping of novel transcriptome-based markers from blackcurrant (Ribes nigrum)" pdf
... Illumina BeadStudio data analysis software (v 3.1) package Each SNP was scored separately and clusters determined automatically or manually into the three expected groups (AA, AB and BB) Preliminary ... entries using a keyword search of Genbank The reads were then searched against this database and any that had a match to a ribosomal RNA sequence with an e-value greater than 1e-10 were discarded ... Following adapter trimming, the sequences were screened for the presence of contaminating ribosomal RNA A small BLAST database containing ribosomal RNA sequences from a variety of plants was constructed...
- 11
- 473
- 0
báo cáo khoa học: " The isolation and mapping of a novel hydroxycinnamoyltransferase in the globe artichoke chlorogenic acid pathway" pptx
... GGGTTTCATATGACTATCGGAGCTCGTGAT CGGGATCCCTAGAAGTCATACAAGCATTT TTTTTAAGCTAACACGAGAC TCTCATAGGAGCTGTAATTG TAAAATGGACGATCAGTATC TTATGTTCAGATTTGGACTC TACTTTCTACAACGAGCTTC ACATGATTTGAGTCATCTTC GGGTTTCATATGAAGATCGAGGTGAGAGAA ... CGGGATCCTTAGATATCATATAGGAACTTGC ATATTCACGACGACTCCGATAGCGGTATCG CACGTCGGCTTCGACTGTAGGTCGACT CACGAGACCAAGTCAATGCACTCAAAGGA GATTCGGGCACTTAAACGTATGAGCCCC CGTGGACTATCAGACGATCAACCATCC TCGTCCGTCAGTAGCCACGTACAGTATC ... Ipomoea batatas (BAA87043); At_HCT, shikimate/quinate hydroxycinnamoyltransferase from Arabidopsis thaliana (ABH04595); Nt_HCT, shikimate/quinate hydroxycinnamoyltransferase from Nicotiana tabacum...
- 13
- 650
- 0
Báo cáo y học: "Value and price of ventilator-associated pneumonia surveillance as a quality indicator" potx
... Intensive Care Med 2004, 30:996-997 doi:10.1186/cc8189 Cite this article as: Aardema LM, et al.: Value and price of ventilator-associated pneumonia surveillance as a quality indicator Critical Care ... the acute care setting Am J Infect Control 2008, 36:309-332 Tulleken JE, Zijlstra JG, Ligtenberg JJ, Spanjersberg R, Van der Werf TS: Ventilator-associated pneumonia: caveats for benchmarking Intensive ... interdisciplinary team Crit Care Med 2006, 34:211-218 Horan TC, Andrus M, Dudeck MA: CDC/NHSN surveillance definition of health care-associated infection and criteria for specific types of infections in...
- 2
- 184
- 0
Báo cáo y học: "Strategy for encoding and comparison of gene expression signatures" pps
... for analyzing microarray data, has defined limitations Signatures were not always extractable from microarray datasets Some GEO records did not have sufficient information to evaluate statistically ... for meta-analysis of microarray data There are many obstacles to the sharing and widespread use of microarray data In general, expression measurements made across microarray technologies are not ... Use of EXALT in meta-analysis Meta-analysis has been demonstrated to provide a strategy for exploiting comparable microarray data from multiple sources to validate observations made by a single...
- 10
- 385
- 0
Báo cáo y học: "Conservation and divergence of gene families encoding components of innate immune response systems in zebrafish" pdf
... oligomerization domain containing protein; Stat, signal transducer and activator of transcription; Tab, Tak1-binding protein; TF, tissue factor; Ticam, Toll-interleukin receptor domain (TIR) containing ... yellow/orange tones = conserved amino-terminal amino acids; and pink = specific aminoterminal peptide of 14 amino acids (b) Details of the alignment in panel a in which amino acid similarities and ... activating factor; CIITA, major histocompatibility complex class II, transactivator; Nod, nucleotide oligomerization domain containing protein fish and Medaka, also associated with NACHT-domain...
- 23
- 259
- 0
Báo cáo y học: " Validation and extension of an empirical Bayes method for SNP calling on Affymetrix microarrays" pot
... 0.995 and calculated the average accuracy of the remaining data to be 0.99915 Applying this average accuracy to other datasets as a rough approximation to a per-call accuracy of 0.995, CRLMM achieves ... of variable albeit typical quality Two 6.0 array datasets, from 44 and 96 HapMap samples, were run at the Chakravarti laboratory for testing purposes The other Chakravarti laboratrory datasets ... (CAPES/Brazil); Shin Lin, David J Cutler, Dan E Arking, and Aravinda Chakravarti were supported by NIH grants HG02757, MH60007, and the DW Reynolds Foundation Note: Aravinda Chakravarti is a...
- 12
- 306
- 0
Báo cáo y học: " Advances in the genetics and epigenetics of gene regulation and human disease" pps
... protein Wnt and the Ras/MAPK intracellular signaling module To identify the mammalian enhancer elements, Hallikas and colleagues have developed a new computational tool (Enhancer Element Locator; ... and phases of the cell cycle In addition, a translational regulator (eIF-3p66) associated with the cyclin/cyclin-dependent kinase pathway was identified The combination of RNAi and gene -expression ... findings suggest that several factors, including both specific DNA sequences and epigenetics, are involved in controlling meiotic recombination in humans Nutritional influences during prenatal and...
- 3
- 265
- 0
Accelerating Test, Validation and Debug of High Speed Serial Interfaces
... performance at one data rate does not correlate to another data rate In either case, good perform- 1.1 Motivation ance at a higher data rate does not guarantee better margin at lower data rates because ... can work under all settings and can accommodate process variations allowed in manufacturing Characterization can in principle be done either in the lab or on Automatic Test Equipment (ATE), and ... of Washington, Luo He at Concordia University, Warren Gross, Kasia Radecka, Atanu Chattopadhyay, Man-Wah Chiang, Rong Zhang, Milos Prokic and Jean-Samuel Chenard at McGill University Altera Corporation...
- 208
- 450
- 0
Tài liệu Báo cáo khoa học: The splicing factor ASF/SF2 is associated with TIA-1-related/ TIA-1-containing ribonucleoproteic complexes and contributes to post-transcriptional repression of gene expression doc
... wellconserved RNA-binding domains mediating RNA contact, and auxiliary domains involved in protein–protein interactions and sub-cellular targeting [3,4] TIA-1related (TIAR) protein belongs to the RNA recognition ... HA-ASF ΔRS1 HA-ASF ΔRS2 HA-ASF FF-DD TIAR Arsenite D Merged HA TIAR Merged HA-ASF/SF2 HA-ASF ΔRS1 HA-ASF ΔRS2 HA-ASF FF-DD HA-ASF W13 4A HA-ASF W13 4A HA-ASF FF-DD W13 4A HA-ASF FF-DD W13 4A Fig 2504 ... expressed at similar levels in Rluc AU8 and Rluc AU0 transfected cells (Fig 6C) Altogether, these results indicate that ASF ⁄ SF2 acts as a negative regulator on ARE-containing mRNAs and that this activity...
- 19
- 666
- 0
Báo cáo khoa học: Structure, mRNA expression and linkage mapping of the brain-type fatty acid-binding protein gene (fabp7 ) from zebrafish (Danio rerio) potx
... gggaGGCGgggctt ttcatCCAAtca ctaaAATTacagtgt atcaatATGCtaata aacatatgTAATaata aggtAATTacaatga ttgattttAAATaaac ATAAtttttaaaca aATGCaaaaa aaatATTCaa cATGCcaatt aatCCAAtaac ccaCCAAtatc tcaCCAAttga ... tcaCCAAttga aggacCCAAtaaggga agcGATAtta taaaGATAaacaa taagaGATAatcgg attaCAATtg caaaCAATgc aagaCAATaa cgaaCAATtt caaaCAATtt TGACgttt aaTGACtaatt atTGACtgaaa ctgaGTCAg Ó FEBS 2003 localized to the adult ... octamer-binding factor POU domain transcription factor/Pit1 POU octamer-binding factor nuclear factor Y nuclear factor Y nuclear factor Y nuclear factor Y GATA-binding factor GATA-binding factor GATA-binding...
- 11
- 366
- 0
Báo cáo khoa học: Structure, linkage mapping and expression of the heart-type fatty acid-binding protein gene (fabp3 ) from zebrafish (Danio rerio) pot
... 0.849 ttaTAAAtcagccag ccCCCCcaggcc gtgaATCAa ggggGGCGgatgg cGTTAattagttttt tGATAataaatgtgaat ttaGATAaaa ccctGATAaatta tgctgGATAagtgg aatGATAata atgaCAATga tataCAATct atatggCCATttagtttatt catCCAAtcgc ... stimulating protein SP1 hepatic nuclear factor hepatic nuclear factor GATA-binding factor GATA-binding factor GATA-binding factor GATA-binding factor Sox-5 Sox-5 Yin and Yang nuclear factor Y ... RNA (plus and minus TAP treatment) were incubated with a 45-base RNA adapter (5¢-GCUGAUGGCGAU GAAUGAACACUGCGUUUGCUGGCUUUGAUGA AA-3¢) and T4 RNA ligase A random-primed reverse transcription reaction...
- 12
- 505
- 0
Báo cáo hóa học: " Respiratory syncytial virus (RSV) attachment and nonstructural proteins modify the type I interferon response associated with suppressor of cytokine signaling (SOCS) proteins and IFN-stimulated gene-15 (ISG15)" potx
... Biomedical Laboratories, Piscataway, NJ) according to the manufacturer's protocol Absorbance at 450 nm was read using the BIO-TEK PowerWave XS microplate reader (Tecan US, Durham, NC) and the data was ... (A) or 48 h (B) as indicated Data are shown as means ± standard errors (SE) of the means lamellar inclusion bodies, maintain functional characteristics of distal respiratory epithelial cells including ... infection Viral infection has been shown to activate TLRs and retinoic acid inducible gene I (RIG-I) signaling pathways leading to phosphorylation of interferon regulatory factor3 (IRF3) and IRF7 and...
- 11
- 435
- 0
Tìm thêm: hệ việt nam nhật bản và sức hấp dẫn của tiếng nhật tại việt nam xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ phát huy những thành tựu công nghệ mới nhất được áp dụng vào công tác dạy và học ngoại ngữ mở máy động cơ lồng sóc các đặc tính của động cơ điện không đồng bộ hệ số công suất cosp fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 động cơ điện không đồng bộ một pha từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25