a suitable candidate for breast cancer chemoprevention

... Ishihara M, Kamiya N, Komiya A, Shimbo M, Suyama T, Sakamoto S, and Ichikawa T Bisphosphonate and low-dose dexamethasone treatment for patients with hormone-refractory prostate cancer Hinyokika ... Neville A, and Tannock IF Economic evaluation of chemotherapy with mitoxantrone plus prednisone for symptomatic hormone-resistant prostate cancer: based on a Canadian randomized trial with palliative ... 1-14 Armstrong AJ, Garrett-Mayer E, Ou Yang YC, Carducci MA, Tannock I, de WR, and Eisenberger M Prostate-specific antigen and pain surrogacy analysis in metastatic hormone-refractory prostate cancer...

Ngày tải lên: 26/10/2012, 09:48

... in human breast cancer cells and therefore have considerable potential for treatment of breast cancer Acknowledgments The authors are grateful for financial support from the National Natural Science ... treatment of breast cancer, oval cancer, small and nonsmall cell lung cancer, prostate cancer, etc Its commercial formulation TaxotereÒ is formulated in high concentration of Tween 80, which has ... internalize through a macropinocytosis-dependent pathway A significant amount of nanoparticles transcytose accumulate at the basolateral membrane Some anionic but not cationic nanoparticles transited...

Ngày tải lên: 22/06/2014, 00:20

... 3d&tabid=2341] doi:10.1186/1477-7819-9-101 Cite this article as: Agrawal et al.: Clinical relevance of “withdrawal therapy” as a form of hormonal manipulation for breast cancer World Journal of ... treatment in advanced breast cancer Lancet 1974, 2:38-39 Hayward JL, Carbone PP, Heuson JC, Kumaoka S, Segaloff A, Rubens RD: Assessment of response to therapy in advanced breast cancer: a project ... & LAPC) 9.5+ (9-23) 9+ (2-23) M = Megestrol acetate; F = Fulvestrant; E = Exemestane; L = Letrozole; MBC = Metastatic Breast Cancer; LAPC = Locally Advanced Primary Breast Cancer; PR = Partial...

Ngày tải lên: 09/08/2014, 02:21

... Consortium Available at: http://breastscreening .cancer. gov/ Ballard-Barbash R, Taplin SH, Yankaskas BC, et al Breast Cancer Surveillance Consortium: a national mammography screening and outcomes database ... Screening a Mammography (film and digital) or MRI for age 40-49 years and ≥70 years b Clinical breast examination alone and with mammography (all ages) c Breast self examination (all ages) Average-risk ... Health Organization (WHO) Screening for breast cancer Available at: http://www.who.int /cancer/ detection/breastcancer/en/index.html Canadian Task Force on Preventive Health Care Breast self-examination...

Ngày tải lên: 14/02/2014, 21:20

... on surgical treatment for breast cancer in Norway: comparative analysis of cancer registry data BMJ 2011;343:d4692 20 NHS cancer screening programmes BASO Breast Audit 1999/2000 www.cancerscreening.nhs.uk/breastscreen/publications.html ... Screening for breast cancer with mammography Cochrane Database Syst Rev 2009;4:CD001877 (available at www.cochrane.dk) Nyström L, Rutqvist LE, Wall S, et al Breast cancer screening with mammography: ... something that might be cancer, the woman is recalled for additional investigations In some cases it turns out that what was seen on the X-ray was benign, and that it was therefore a false alarm If...

Ngày tải lên: 15/02/2014, 05:20

... 48 MAKARA, TEKNOLOGI, VOL 13, NO 1, APRIL 2009: 47-51 energy crops [6-7] Microalgae systems also use far less water than traditional oilseed crops For these reasons, microalgae are capable of ... per unit area of land, compared to terrestrial oilseed crops Microalgae are very efficient biomass capable of taking a waste (zero energy) form of carbon (CO2) and converting it into a high density ... extracted The effect of drying temperature was investigated in this study Gas chromatography analysis Sample was dissolved in ethyl acetate and 0.5 µL of this was injected into a Shimadzu GC-17A...

Ngày tải lên: 21/02/2014, 10:20

... 48 MAKARA, TEKNOLOGI, VOL 13, NO 1, APRIL 2009: 47-51 energy crops [6-7] Microalgae systems also use far less water than traditional oilseed crops For these reasons, microalgae are capable of ... per unit area of land, compared to terrestrial oilseed crops Microalgae are very efficient biomass capable of taking a waste (zero energy) form of carbon (CO2) and converting it into a high density ... extracted The effect of drying temperature was investigated in this study Gas chromatography analysis Sample was dissolved in ethyl acetate and 0.5 µL of this was injected into a Shimadzu GC-17A...

Ngày tải lên: 21/02/2014, 10:20

... Japan) and photographed digitally on a Gatan axismount 2k × 2k digital camera (Gatan, Inc., Pleasanton, CA, USA) The freeze-dried samples were put into a small mold, referred to as a BEEM capsule, ... TEM for imaging on a Gatan digital camera Powder X-ray diffraction pattern analysis Powder X-ray diffraction [PXRD] analysis of the freeze-dried NCs was performed using a MiniFlex automated X-ray ... 10 kDa and 30 to 70 kDa) and ethyl acetate were obtained from Sigma-Aldrich (St Louis, MO, USA) Docetaxel or Doc was purchased from LC Laboratories (Woburn, MA, USA) Labrafac CC (caprylic/capric...

Ngày tải lên: 18/06/2014, 22:20

... Camilla Mollatt, and Anne K Hjelmerud of Norwegian Radium Hospital, and Åsmund Larsen and Ellen M Brevik of Algeta ASA, for technical assistance We thank Lars Abrahamsen and Thomas Ramdahl at ... Days after injection 40 60 80 100 120 Days after injection NaCl Cold-Trastuzumab 200 kBq/kg 227Th-trastuzumab Th trastuzumab Aspartate Amino otransferase (U/L) Alkaline Phos sphatase (U/L) NaCl ... incubated for h before washing and measurement of radioactivity with an automated gamma counter (Wizard, Packard Instrument Co., Downers Grove, IL, USA) IRF was 70% to 90% Animals All procedures and...

Ngày tải lên: 21/06/2014, 01:20

... dimethacrylate coated onto a fused silica capillary, and is suitable for analyzing hydrocarbons (natural gas, refinery gas, C1–C7, all C1–C3 isomers except propylene and propane); CO2, methane, air/CO, ... s Analysis time Variable (Max 600 s) Variable (Max 600 s) Column pressure Fig Chromatogram of a synthetic air, and b TMA (presenting peaks of air and TMA) analyzed in ‘‘Plot A ’ In chromatogram ... doi:10.1021/la061187w ´ ` 18 O Casals, A Romano-Rodrıguez, X Illa, C Zamani, A Vila, ` ´ J.R Morante, I Gracia, P Ivanov, N Sabate, L Fonseca, ´ J Santander, E Figueras, C Cane, Micro and nanotechnologies...

Ngày tải lên: 22/06/2014, 00:20

... integrated analysis of miRNA expression, mRNA expression and genomic changes in breast cancer They showed that many miRNAs have a variable expression across breast tumor samples As found at the ... Charafe-Jauffret E, Cervera N, Desplans J, Parzy D, Schoenmakers E, Viens P, Jacquemier J, Birnbaum D, Bertucci F, Chaffanet M: Inte grated profiling of basal and luminal A breast cancers Cancer ... some miRNAs correlated with the molecular subtypes and with two major features of breast cancer (grade and ER status) [2] The authors [2] used an integrated approach to analyze the reasons for the...

Ngày tải lên: 06/08/2014, 18:21

... Tulusan A, Kubista E: Sealing of postoperative axillary leakage after axillary lymphadenectomy using fibrin glue coated collagen patch: a prospective randomized study Breast Cancer Res Treat 2001, ... Blumencranz PW, Leitch AM, Saha S, McCall LM, Morrow M: Axillary dissection vs no axillary dissection in women with invasive breast cancer and sentinel node metastasis: a randomized clinical trial JAMA ... seroma formation after axillary lymphadenectomy for breast cancer? A prospective randomized trial in 159 patients J Surg Onc 2010, 101:600-3 Berger A, Tempfer C, Hartmann B, Kornprat P, Rossmann A, ...

Ngày tải lên: 09/08/2014, 02:20

... tamoxifen-treated breast cancer patients: findings from the National Surgical Adjuvant Breast and Bowel Project (NSABP) B-14 J Natl Cancer Inst 1994, 86(7):527-37 Jordan VC: Biochemical pharmacology of antiestrogen ... their patient with elevated liver transaminase levels The second case was reported in 2002 by Arnould et al [7]; they described a case of metastases of a breast carcinoma to an adult granulosa cell ... Goa KL: Tamoxifen: A reappraisal of its pharmacodynamic and pharmacokinetic properties, and therapeutic use Drugs 1989, 37:451-490 18 Lonning PE, Hall K, Aakvaag A, Lien EA: Influence of tamoxifen...

Ngày tải lên: 09/08/2014, 03:22

... clinical and radiological examination, including mammography and ultrasound The radiological appearance of the lesion was characterized according to the American College of Radiology Breast Imaging ... employed for "histological underestimation" was a lesion diagnosed as ADH at CNB that was revealed to harbor malignant foci at follow-up surgical excision, including DCIS and invasive cancer All patients ... Proliferative breast "disease" An unresolved diagnostic dilemma Cancer 1993, 71:3798-3807 Shackney SE, Silverman JF: Molecular evolutionary patterns in breast cancer Advances in anatomic pathology...

Ngày tải lên: 09/08/2014, 04:21

... 7:467-71 The START Trialists’ Group: The UK Standardisation of Breast Radiotherapy (START) Trial A of radiotherapy hypofractionation for treatment of early breast cancer: a randomised trial Lancet 2008, ... 9:331-41 The START Trialists’ Group: The UK Standardisation of Breast Radiotherapy (START) Trial B of radiotherapy hypofractionation for treatment of early breast cancer: a randomised trial Lancet 2008, ... Kumada M, Nemoto K, Iwase T, Yamashita T: Acute radiation dermatitis and pneumonitis in Japanese breast cancer patients with whole breast hypofractionated radiotherapy compared to conventional...

Ngày tải lên: 09/08/2014, 09:20

... patients), median age at exposure and attained age for the published breast cancer rates after Hodgkin’s disease radiotherapy Published breast cancer risk after Hodgkin’s disease Cohort size Age ... 1 Mantle Mantle field alone 637 3.2 2.7 (1.1-6.9) other Supradiaphragmatic Supraclavicular/neck 34 Axillary + Mediastinal/ homolat 41 Axillary + Mediastinal/bilat Axillary, no Media 14 Total ... of model parameters for a dose-response relationship for breast cancer covering dose levels relevant for radiotherapy In addition a model for the age dependence of breast cancer risk was verified...

Ngày tải lên: 09/08/2014, 09:20

... 5'-AAGGACAGGATCCACTTGACCTATAGTGAGTCGTATTA-3' 5'AAGGTCAAGTGGATCCTGTCCTATAGTGAGTCGTATTA3' siRNA2 5'-AAGGTGAACTTGGTCTGGGCCTATAGTGAGTCGTATTA3' 5'-AAGGCCCAGACCAAGTTCACCTATAGTGAGTCGTATTA-3' siRNA3 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' ... 5'-AAGTAGAGATTAAAGGCCCACTATAGTGAGTCGTATTA-3' 5'-AAGTGGGCCTTTAATCTCTACTATAGTGAGTCGTATTA-3' siRNA4 5'-AAGCTCATGATGTTCTCATCCTATAGTGAGTCGTATTA-3' 5'-AAGGATGAGAACATCATGAGCTATAGTGAGTCGTATTA-3' siRNA5 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' ... 5'-AAGTGTAGCAATCTGTTCACTATAGTGAGTCGTATTA-3' 5'-AAGTGAACAGATTGCTACACTATAGTGAGTCGTATTA-3' siRNA-GFP 5'-ATGAACTTCAGGGTCAGCTTGCTATAGTGAGTCGTATTA-3' 5'-CGGCAAGCTGACCCTGAAGTTCTATAGTGAGTCGTATTA-3' T7 5'-TAATACGACTCACTATAG-3'...

Ngày tải lên: 09/08/2014, 10:23

... TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCGAGCAGGTTGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC t p.G60V ... Gorilla gorilla Pongo pygmaeus Macaca mulatta Callithrix jacchus TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC TCTCCCTCCAAGCAGGTCGAAGAAGGGGGCAAAGCAGACACCCTGAGCTCC ... manuscript SL and TS evaluated and interpreted SNP microarray and aCGH data All authors read and approved the final manuscript for publication Acknowledgments We thank the heterotaxy patients and families...

Ngày tải lên: 09/08/2014, 23:20