a substance and procedure a multi streamed jurisdiction

... (greek,serbian), (greek,maya) (hebrew,zapotec), (japanese,turkish) (japanese,kannada), (kannada,turkish) (malay,yoruba), (maya,serbian) The contrasts (uniquely) were made with a minimal set of features: ... re-discovered some classical analyses (of the Amerindian language Seneca by Lounsbury), has successfully analyzed previously unanalyzed languages (e.g., Bulgarian), and has improved on previous analyses of ... Two classes C1 and C2 are contrasted by a Boolean or nominal feature if the instances of C1 and the instances of C2 not share a value • Two classes C1 and C2 are contrasted by a numeric feature...

Ngày tải lên: 08/03/2014, 06:20

... of data as baseline and the second year as comparator Finally, an additional and similar analysis was performed for hospitals that had participated in the MERIT study A P value of less than 0.05 ... hospitals participating in the Medical Emergency Response and Intervention Trial ANZICS-APD, Australian and New Zealand Intensive Care Society Adult Patient Database tals, and tertiary hospitals ... numbers and as a percentage of overall cases or events Data on adverse events (ICU admission due to ward CA and readmission to ICU) are presented as means ± standard deviation for absolute values and...

Ngày tải lên: 25/10/2012, 10:35

... temperature from the flat plate collectors, latent heat and refined latent heat of vaporization of water from each stage and specific heat capacity of water from each stage are averaged over the day ... Non-conventional solar stills with charcoal particles as absorber medium Desalination 2003, 153(1-3), 55–64 [3] Al-Abbasi M .A. , Al-Karaghouli A. A., Minasian A. N Photochemically assisted solar desalination ... variation of global solar radiation and ambient temperature at Chennai for January to June _ Solar radiation -Ambient temperature Figure Mean monthly hourly variation of global solar radiation...

Ngày tải lên: 05/09/2013, 16:11

... AGTAAGGAAAATAAGCTTGGGCATGATCCC GCTCACTGCCTAAGCTTTGTAGCTAATAAAG CTTTATTAGCTACAAAGCTTAGGCAGTGAGC CTTTGTTATTTATTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAATAAATAACAAAG CTTTGTTAAAGCTTATGCATTCCTATGGTGAGTT AACTCACCATAGGAATGCATAAGCTTTAACAAAG ... SJS170 ALS030 SJS209 SJS275 SJS276 CGGAAGATCTAACTAAGCGTGCTGCTTC TACGAGATCTGTTGTTTGGAAGCAGGTT CGGAAGATCTGGGATCATGCCCATTTAG TACGAGATCTTAGCTACATTAAATAGGC GGGATCATGCCCAAGCTTATTTTCCTTACT AGTAAGGAAAATAAGCTTGGGCATGATCCC ... AACTCACCATAGGAATGCATAAGCTTTAACAAAG CCTCTTACACTTGCTTTTGAC GCAAAGGTGCCTTTGAGGTTG GACCCCTTCATTGACCTCAACTA CTTGATTTTGGAGGGATCTC TTAGCTACATTAAATAGGCAG GtaatacgactcactataGGGATCATGCCCATTTAG Forward (nt 1281–1298...

Ngày tải lên: 16/02/2014, 09:20

... cells and cardiac myocytes J Mol Cell Cardiol 33, 2179–2187 11 Tanaka, T., Kanai, H., Sekiguchi, K., Aihara, Y., Yokoyama, T., Arai, M., Kanda, R & Kurabayashi, M (2000) Induction of VEGF gene transcription ... C) and a National Health and Medical Research Committee program grant (M A V, G J G.) References Yancopoulos, G.D., Davis, S., Gale, N.W., Rudge, J.S., Wiegand, S.J & Holash, J (2000) Vascular-specific ... [26,27,42] and IRES-driven translation [43–46] it is possible that the CSD/PTB sites play a role in translation as well as stabilization of the VEGF mRNA A combined role in mRNA stability and translation...

Ngày tải lên: 19/02/2014, 12:20

... Biotechnology and Organic Agriculture: National Organic Standards, Labeling and Second-Generation of GM Products Paper presented at the AAEA annual meeting, Montreal, Canada, July Golan, E., Kuchler, ... Chain: The Market and Welfare Effects of Different Labeling and Regulatory Regimes American Journal of Agricultural Economics 86(1): 42-60 32 Giannakas, K., and Yiannaka, A (2003) Agricultural Biotechnology ... with the analyses of Lapan and Moschini (2004), Fulton and Giannakas (2004), and Sobolevsky, Moschini, and Lapan (2005) There are at least four reasons for that First, here we explicitly allow for...

Ngày tải lên: 05/03/2014, 20:20

... heterosexual males with PE and female partners of males with PE in the US, UK, Italy, France, Germany, and Poland and (2) to cognitively debrief males with PE and female partners of males with PE about ... content analyses, interpreted the qualitative data, and drafted and revised the manuscript KH, SM and JH conducted the qualitative research and Page of 10 (page number not for citation purposes) Health ... meta-analysis Int J Impot Res 2004, 16(4):369-381 Rowland DL, Strassberg DS, de Gouveia Brazao CA, Slob AK: Ejaculatory latency and control in men with premature ejaculation: an analysis across...

Ngày tải lên: 18/06/2014, 22:20

... taking into account the phrasing of the items and their meaning Exploratory factor analysis (EFA): The sample was randomly divided into two halves; one each for EFA and CFA EFA for all 182 candidate ... Cite this article as: Vaingankar et al.: The positive mental health instrument: development and validation of a culturally relevant scale in a multi- ethnic asian population Health and Quality of ... scale, and after evaluating different transformations, decided that a dichotomous scale resulting from collapsing categories 1-3 into a single category and leaving category as is was optimal...

Ngày tải lên: 20/06/2014, 15:20

... Noncommutative symmetric functions II Transformations of alphabets Internat J Algebra Comput., 7(2):181–264, 1997 [12] Alain Lascoux, Bernard Leclerc, and Jean-Yves Thibon Crystal graphs and qanalogues ... functions and the Solomon descent algebra J Algebra, 177(3):967–982, 1995 [15] Fr´d´ric Patras and Christophe Reutenauer On Dynkin and Klyachko idempotents e e in graded bialgebras Adv in Appl Math., ... free Lie algebra and q-enumeration In Invariant theory and tableaux (Minneapolis, MN, 1988), volume 19 of IMA Vol Math Appl., pages 166–190 Springer, New York, 1990 [3] Charles W Curtis and Irving...

Ngày tải lên: 07/08/2014, 08:22

... and termed ‘aggrecanase’ [25] Several of these ADAMTS proteinases also cleave the related hyalectan versican at analogous sites and ADAMTS-4 has been demonstrated to cleave a further hyalectan, ... region are arranged in one, two or three tandem arrays Between arrays is either a short linker sequence (ADAMTS-9 and ADAMTS-20) or a mucin-like domain (ADAMTS-7 and ADAMTS-12) [17] Four additional ... cleavage is a characteristic event in the catabolism of cartilage aggrecan in the arthritides [29-31] The potential importance of aggrecanasemediated degradation of aggrecan in cartilage, particularly...

Ngày tải lên: 09/08/2014, 06:23

... in Canada, Australia, and New Zealand The Lancet 2007, 9527(367):2029-2031 31 Anderson I: Recent developments in national Aboriginal and Torres Strait Islander health strategy Australia and New ... to address Others raised these same issues but saw the information as an advantage because data could be aggregated at a regional level for analysis and addressed as part of broader policy and ... 1Australian Primary Health Care Research Institute, Australian National University, Canberra, Australia and 2Menzies School of Health Research, Darwin, Australia Received: 28 July 2009 Accepted: 13 March...

Ngày tải lên: 11/08/2014, 05:21

... Sudan from Africa; Argentina, Chile, El Salvador and Mexico from Latin America; Russia and Georgia from Europe; China, India, Malaysia, Pakistan and Thailand from Asia In the Chinese context, each ... data are sent from local GIPAP participating physicians to the central database quarterly The data are stored in the central system at TMF headquarters in Seattle All data are anonymous and are ... population, (Russia, Argentina, Chile, Mexico and Georgia), African countries with large populations (South Africa, Nigeria, Kenya and Sudan) and representative Latin American countries such as...

Ngày tải lên: 11/08/2014, 14:21

... [29] A qualitative approach was employed which provided rich data grounded in stakeholders views and ideas [30] With 52 participants, the sample was large and thematic saturation was assured A particular ... refined and elaborated in light of incoming data and analysis employing an inductive stance The interviewer conducted the analysis on all interviews In addition, each interview was separately analyzed ... recognized that involving families can provide an additional burden to clinicians’ caseload and require additional clinical skills Additional training and support is necessary for health professionals...

Ngày tải lên: 11/08/2014, 16:20

... index PALLIAT MED 1998, 12:231-244 Namisango E, Katabira E, Karamagi C, Baguma P: Validation of the Missoula-Vitas Quality-of-Life Index among patients with advanced AIDS in urban Kampala, Uganda ... of Health RoU: National Sector Strategic Plan 2000/01 - 2004/05 Kampala, Ministry of Health; 2000 12 Jagwe J, Merriman A: Uganda: Delivering Analgesia in Rural Africa: Opioid Availability and ... SeTswana, Luganda, and Runyoro) The target sample was 60 patients per site, giving a total of approximately 300 This was considered a feasible Page of 14 target given the time available and the...

Ngày tải lên: 12/08/2014, 01:22

... cagaatatggtgcactgtgc agtctatgaagcccacctgtg 59 huPDE 7A for huPDE 7A rev tcaggccatgcactgttact cctgattctctcaataagccc 57 huPbib for huPbib rev agagcatctacggtgagcg cttccgcaccacctcca 57 aReverse Annealing ... obtained from COPD patients [14-16] In airways, elevation of intracellular cAMP has been associated with the general suppression of activity of inflammatory cells and relaxation of airway and vascular ... oxygen radicals, elastases and metalloproteases (MMP) that contribute to self-perpetuation of inflammation and promote matrix breakdown, leading to alveolar destruction and emphysema [10-12] Patients...

Ngày tải lên: 12/08/2014, 14:20

... separated through a 1% agarose gel and analyzed for the presence and correct size of each amplicon Each product was graded as strong, acceptable, questionable, smear, misprimed, or failed and ... using a human genomic β-actin calibration curve Absolute viral and β-actin DNA copy number was assessed and final viral DNA load per 106 cells was calculated by the following formula: [HHV-6 DNA ... Immunosorbent Assay (ELISA) and Northern blot analysis that not allow for simultaneous multi- target analysis To determine whether a multi- virus microarray had potential in specific applications, for instance...

Ngày tải lên: 13/08/2014, 13:20

... Development and implementation of a high-quality clinical database: the Australian and New Zealand Intensive Care Society Adult Patient Database J Crit Care 2006, 21:133-141 25 Australian and New Zealand ... aged ≥ 80 years for Australia and New Zealand (ANZ) from 2006 to 2015 ANZICS APD, Australian and New Zealand Intensive Care Society Adult Patient Database in crude hospital mortality (-20%; 95% ... 2005 (a) Mean and standard deviation Acute Physiology and Chronic Health Evaluation (APACHE) II and nonage APACHE II scores (b) Crude mortality with 95% confidence interval and adjusted odds ratio...

Ngày tải lên: 13/08/2014, 16:20

... in social-emotional competence at the beginning and at the end of the kindergarten year: A two factorial (gender, ethnic group) multivariate analysis of variance was calculated to compare the ... Hieshima JA, Schneider B: Intergenerational effects on the cultural and cognitive socialization of third- and fourth-generation Japanese Americans: Diversity and development of Asian Americans Journal ... Journal of Applied Developmental Psychology 1994, 15:319-327 Samples FL: Cognitions, behaviours and psychological symptomatology: Relationships and pathways among African American and Latino...

Ngày tải lên: 13/08/2014, 18:21

... protocol and after the study database had been analyzed Randomization codes were generated using a pseudo-random number generator and stickers for randomization envelopes were generated automatically ... identification number Patients were enrolled from sites in North America, Thailand and Australia, between 2002 and 2005 Study material or placebo was administered in a 100 mL bag of normal saline Addition ... acquisition of data and the interpretation of data PM and PW drafted the manuscript and PM, JP, KG, PW and MA revised it critically for important intellectual content PM, JP, KG, PW and MA have...

Ngày tải lên: 13/08/2014, 21:20