a specialist in disorders of the stomach and intestines

Tài liệu Live Red in support of the Heart and Stroke Foundation of Manitoba pdf

Tài liệu Live Red in support of the Heart and Stroke Foundation of Manitoba pdf

Ngày tải lên : 19/02/2014, 03:20
... Red casual day fundraisers are very popular and simple to plan. Dinner, gala or social - Coordinate an evening of dinner and dancing in support of HSFM. Benefit dinners are great for rewarding ... the presence of an audit trail. What is a gift -in- kind and are they eligible for a tax receipt? “Gifts -in- kind” are gifts of physical property and according to the CRA are eligible for tax ... exceed the lesser of 10% of the value of the gift and $75, then the value of the advantage is considered to be zero. For example, if the price to attend the benefit dinner is $200 and the value of...
  • 57
  • 557
  • 0
Tài liệu The Color Line A Brief in Behalf of the Unborn pptx

Tài liệu The Color Line A Brief in Behalf of the Unborn pptx

Ngày tải lên : 19/02/2014, 11:20
... names of Hammurabi and Zarathustra and Moses and the Buddha and Mohammed, of Homer and Plato and Phidias and Socrates and Pindar and Pythagoras, and the mightiest Julius, and the imperial philosophers, ... Indo-European and Semitic races, the stories of Babylon and Nineveh, of Thebes and Memphis, of Rome and Athens and Jerusalem, of Delhi and of Bagdad, of the Pyramids and of the Parthenon the radiant names ... discovered), in the Gaboon, along the lower Zambesi, and in the Benua and Shari basins, the African aborigines present almost a greater uniformity of physical and moral type than any of the other great...
  • 90
  • 476
  • 0
A RIP VAN WINKLE OF THE KALAHARI AND OTHER TALES OF SOUTH-WEST AFRICA doc

A RIP VAN WINKLE OF THE KALAHARI AND OTHER TALES OF SOUTH-WEST AFRICA doc

Ngày tải lên : 06/03/2014, 03:21
... Klein Namaqualand, and Gordonia, Cape Colony, and what was at that time known as German South- West Africa. Four of them appeared a few years back in The State an illustrated magazine now unhappily ... and I remembered all. The girl in England, old Anderson, Inyati, and the blue diamond; my ride and fall; all these came back to me almost in a flash, stunning and amazing me; but for long the ... and living on the fat of the land. Game there was in abundance, so much so, indeed, that they were a cause of anxiety, for the water in the vlei was decreasing rapidly from the number of animals...
  • 160
  • 619
  • 1
Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

Báo cáo khoa học: Cloning of a rat gene encoding the histo-blood group A enzyme Tissue expression of the gene and of the A and B antigens potx

Ngày tải lên : 31/03/2014, 09:20
... encoding inactive products. The A transferases catalyse the transfer of an N-acetylgalactosamine to acceptor H substrates (Fuca1,2Galb-) whereas the B transferases catalyse the transfer of a galactose ... temper- ature. Amplification of the cDNA corresponding to the A enzyme cDNA was performed with the following primers: CAGACGGATGTCCAGAAAGTTG and: GCTACAG GTACCGCCTCTCCAA. Amplification was performed using the ... such as the gut, the higher respiratory tract and the genito-urinary tract. In some primates, they are present on the vascular endothelium of all tissues and in chimpanzee, gorilla and man they are...
  • 8
  • 499
  • 0
Báo cáo hóa học: " Functional polymorphisms in genes of the Angiotensin and Serotonin systems and risk of hypertrophic " ppt

Báo cáo hóa học: " Functional polymorphisms in genes of the Angiotensin and Serotonin systems and risk of hypertrophic " ppt

Ngày tải lên : 18/06/2014, 16:20
... gene mutations. In each family, we indicated the mutation, the number of mutation carriers in the family who were AT1R CC/AC or AA, and the mean onset age and mean LVWT according to the AT1R genotype. Received: ... Morales 1 , Francisco Ortega 4 , Ana I Corao 1 , Marta Díaz 1 , Beatriz Tavira 1 and Victoria Alvarez 1 Abstract Background: Angiotensin and serotonin have been identified as inducers of cardiac hypertrophy. ... from the Northern Spain regions of Asturias and Cantabria, and gave their informed consent to participate in the study, approved by the Ethical Committee of Hospital Central Asturias. Sarcomeric...
  • 9
  • 537
  • 0
Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"

Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"

Ngày tải lên : 25/10/2012, 10:02
... guidelines for the management of patients with unstable angina and non-ST- segment elevation myocardial infarction. A report of the American College of Cardiology/American Heart Association Task ... statistical anal- yses. Categorical data are presented as absolute and relative frequencies, continuous variables as median with inter-quartile range (IQR). Since distribution of data of the continuous ... shock); ii) acute coronary syndrome (myocardial infarction and unstable angina); and iii) all other admis- sion diagnoses. This division was made due to the fact that sepsis and acute coronary syndromes...
  • 8
  • 656
  • 1
Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

Báo cáo khoa học: " Medication errors: a prospective cohort study of hand-written and computerised physician order entry in the intensive care unit"

Ngày tải lên : 25/10/2012, 10:39
... critically revising the draft. JG made substantial contributions to the data analysis. GB was substantially involved in the analysis, interpretation and drafting the manuscript. Acknowledgements To the Medical ... and the ICU clinical director, according to an adapted scale [9-11]. Minor errors were classified as those causing no harm or an increase in patient monitoring with no change in vital signs and ... cases, nurses administered medication without a legally valid physi- cian order. Although an absent 'signature' with CPOE was regarded as an error, the audit facility of the Clinical Informa- tion...
  • 6
  • 525
  • 0
On a Fundamental Reorganisation of the Landesbanks and Savings Banks Sector in Germany ppt

On a Fundamental Reorganisation of the Landesbanks and Savings Banks Sector in Germany ppt

Ngày tải lên : 15/03/2014, 10:20
... German Landesbanks lack a stable and self-sustaining business model and have neither a sustainable, robust income structure nor a resilient balance sheet. In particular, the refinancing of Landesbanks ... DekaBank and transfer DekaBank to the sole ownership of the savings banks. DekaBank and other banks of the S-Finanzgruppe [savings banks financial group] that are owned by the savings banks ... the Landesbank problem. First, we have not examined legal issues, in particular the question of the public mandate of savings banks and Landesbanks, as well as rules and regulations from the...
  • 26
  • 499
  • 0
Protecting Children''''s Health In A Changing Environment - Report Of The Fifth Ministerial Conference On Environment And Health.pdf potx

Protecting Children''''s Health In A Changing Environment - Report Of The Fifth Ministerial Conference On Environment And Health.pdf potx

Ngày tải lên : 22/03/2014, 16:22
... States Albania Andorra Armenia Austria Azerbaijan Belarus Belgium Bosnia and Herzegovina Bulgaria Croatia Cyprus Czech Republic Denmark Estonia Finland France Georgia Germany Greece Hungary Iceland Ireland Israel Italy Kazakhstan Kyrgyzstan Latvia Lithuania Luxembourg Malta Monaco Montenegro Netherlands Norway Poland Portugal Republic ... Republic Denmark Estonia Finland France Georgia Germany Greece Hungary Iceland Ireland Israel Italy Kazakhstan Kyrgyzstan Latvia Lithuania Luxembourg Malta Monaco Montenegro Netherlands Norway Poland Portugal Republic of Moldova Romania Russian Federation San Marino Serbia Slovakia Slovenia Spain Sweden Switzerland Tajikistan The ... main priority areas. The rst was the progress and impact of the environment and health process, particularly in the countries of south- eastern and eastern Europe, the Caucasus and central...
  • 92
  • 501
  • 0
Báo cáo khoa học: Stabilities and activities of the N- and C-domains of FKBP22 from a psychrotrophic bacterium overproduced in Escherichia coli pptx

Báo cáo khoa học: Stabilities and activities of the N- and C-domains of FKBP22 from a psychrotrophic bacterium overproduced in Escherichia coli pptx

Ngày tải lên : 23/03/2014, 13:20
... 5Â-AGAGAGAA TT CATATGTCAGATTTGTTCAG-3Â for N-domain + ,5Â- CTGAAAACGCTAAG CATATGGGTATTACGA-3Â for C-domain , and 5Â-CTTGCTGATGCACATATGGGGAA AGAAAGC-3Â for C-domain + , where underlined bases show the position of the NdeI ... [10] and E. coli FkpA [11], these proteins are com- posed of N- and C-domains, which are spanned by a 40 amino acid long a3 helix. The N-domain consists of a1 and a2 helices and an N-terminal region ... N-domain + and 34% for SIB1 FKBP22*), suggesting that N-domain + assumes a similar helical structure to that of the N-domain in the intact molecule. On the other hand, the CD spectra of C-domain + and...
  • 11
  • 332
  • 0
Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx

Báo cáo Y học: A new siglec family member, siglec-10, is expressed in cells of the immune system and has signaling properties similar to CD33 docx

Ngày tải lên : 24/03/2014, 04:21
... digesting the fragment with HindIII and Bgl II and the plasmid with HindIII and Bam HI. The fragment was ligated into the plasmid and the integrity of the insertion was validated by digesting the ... increase in number at sites of in ammation and each are capable of modifying the overall in ammatory response [23]. Eosinophils, are of particular interest in asthma and allergy due to their con- spicuous ... driving the pathogenesis of asthma and other allergic diseases by damaging tissue and releasing pro -in ammatory agents. Activated eosinophils, neutro- phils, macrophages and lymphocytes increase...
  • 14
  • 540
  • 0
The History of Banks: To Which Is Added, a Demonstration of the Advantages and Necessity of Free Competi- tion In the Business of Banking. Richard Hildreth doc

The History of Banks: To Which Is Added, a Demonstration of the Advantages and Necessity of Free Competi- tion In the Business of Banking. Richard Hildreth doc

Ngày tải lên : 29/03/2014, 07:20
... time all these floating capitals are securely invested, paying a moderate interest, and capable of being brought into action at a moment s warning. Many of the Massachusetts and Rhode Island banks, ... go on; and unless war returns again to curse the earth and barbarize its inhabitants, the science and industry of the present age will accumulate stores of wealth, and means of comfort and pleasure, ... Company, and the China Company; and now assumed the title of the Company of the Indias. The Company next acquired the privilege of farming all the taxes and the whole revenue of the kingdom; and presently...
  • 78
  • 775
  • 0

Xem thêm