a space odyssey full movie with subtitles
A simple introduction to working with LVM
... this example hda1, hda2, and hda3 are all physical volumes. We'll initialize hda3 as a physical volume:root@lappy:~# pvcreate /dev/hda3If you wanted to combine several disks, or partitions ... logical volume manager allows you to create and manage the storage of your servers in a very useful manner; adding, removing, and resizing partitions on demand. Getting started with LVM can be a ... metadata type lvm2Now that we have a volume group (called skx-vol) we can actually start using it.Working with logical volumesWhat we really want to do is create logical volumes which we can...
- 7
- 674
- 0
Báo cáo y học: "A cyclic-RGD-BioShuttle functionalized with TMZ by DARinv “Click Chemistry” targeted to αvβ3 integrin for therapy"
... Harms JF, Welch DR, Samant RS, et al. A small molecule antagonist of the alpha(v)beta3 integrin suppresses MDA-MB-435 skeletal metastasis. Clin Exp Metastasis. 2004; 21: 119-28. 3. Takada ... Sakamoto S, Kyprianou N. Targeting anoikis resistance in prostate cancer metastasis. Mol Aspects Med. 2010 Apr;31(2):205-14. 5. Zanardi LA, Battistini L, Burreddu P, et al. Targeting alpha(v)beta(3) ... organic phase was washed with water, followed by 1N HCl and again water. The organic layer was dried over Na2SO4 and evaporated. The resulting residue was chromatographed on silica gel by...
- 14
- 480
- 0
OReilly.Building.a.Web.2.0.Portal.with.ASP.NET.3.5.Jan.2008-BBL
... can add more widgets from a widget catalog and decorate the page as they like.How an Ajax-Powered Start Page Is DifferentThe advantages of Ajax and a rich client-side experience give users a ... any part of the Start page asynchronously and giveany web site an Ajax look-and-feel. However,UpdatePanels are a significant drag onthe page. The moreUpdatePanels you have, the slower asynchronous ... have already devel-oped one or more web applications and have a good grip on JavaScript and ASP.NET2.0. The reader is also expected to have basic understanding of ASP.NET AJAX. Thisinformation...
- 310
- 488
- 1
Tài liệu ADX Active Digital Cross-Connect A Space in Time pptx
... to an SDH multiplexer as a fiber pair rather than as a bundle of 63 copper pairs. This unique feature offers substantial space saving.ADX Active Digital Cross-Connect – A Space in TimePage ... interface cards) Early GSM operators chose TDM because of its many advantages. The technology is time-tested and relatively simple, enabling operators at any given time to know what traffic ... eventually capture a larger share of the average revenue per user (APRU), voice is—and will remain a killer application. Teenagers, craftsmen, businesspeople and just about everyone on the go has come...
- 4
- 296
- 0
Tài liệu 20 Terabytes a Night by Doug Rosenberg with Matt Stephens doc
... a night 21 summarizes the challenge facing Jeff and Tim very nicely: The LSST websiteThe science archive will consist of 400,000 sixteen‐megapixel images per night (for 10 years), comprising 60 PB of pixel data. This enormous LSST data archive and object database enables a diverse multidisciplinary research program: astronomy & astrophysics; machine learning (data mining); exploratory data analysis; extremely large databases; scientific visualization; computational science & distributed computing; and inquiry‐based science education (using data in the classroom). Many possible scientific data mining use cases are anticipated with this database. The LSST scientific database will include: * Over 100 database tables * Image metadata consisting of 700 million rows * A source catalog with 3 trillion rows * An object catalog with 20 billion rows each with 200+ attributes * A moving object catalog with 10 million rows * A variable object catalog with 100 million rows * An alerts catalog. Alerts issued worldwide within 60 seconds. * Calibration, configuration, processing, and provenance metadata Sky Movies—Challenges of LSST Data Management The Data Management (DM) part of the LSST software is a beast of a project. LSST will deal with unprecedented data volumes. The telescope’s camera will produce a stream of individual images that are each 3.2 billion pixels, with a new image coming along every couple of minutes. In essence, the LSST sky survey will produce a 10 year “sky movie . If you think of telescopes like LBT producing a series of snapshots of selected galaxies and other celestial objects, and survey telescopes such as Sloan producing a “sky map”22, then LSST’s data stream is more analogous to producing a 10 year, frame‐by‐frame video of the sky. LSST’s Use Cases Will Involve Accessing the Catalogs LSST’s mandate includes a wide distribution of science data. Virtually anyone who wants to will be able to access the LSST database. So parts of the LSST DM software will involve use cases and user interfaces for accessing the data produced by the telescope. Those data mining parts of the software will be designed using regular use‐case‐driven ICONIX Process, but they’re not the part of the software that we’re concerned with in this book. ... a night 21 summarizes the challenge facing Jeff and Tim very nicely: The LSST websiteThe science archive will consist of 400,000 sixteen‐megapixel images per night (for 10 years), comprising 60 PB of pixel data. This enormous LSST data archive and object database enables a diverse multidisciplinary research program: astronomy & astrophysics; machine learning (data mining); exploratory data analysis; extremely large databases; scientific visualization; computational science & distributed computing; and inquiry‐based science education (using data in the classroom). Many possible scientific data mining use cases are anticipated with this database. The LSST scientific database will include: * Over 100 database tables * Image metadata consisting of 700 million rows * A source catalog with 3 trillion rows * An object catalog with 20 billion rows each with 200+ attributes * A moving object catalog with 10 million rows * A variable object catalog with 100 million rows * An alerts catalog. Alerts issued worldwide within 60 seconds. * Calibration, configuration, processing, and provenance metadata Sky Movies—Challenges of LSST Data Management The Data Management (DM) part of the LSST software is a beast of a project. LSST will deal with unprecedented data volumes. The telescope’s camera will produce a stream of individual images that are each 3.2 billion pixels, with a new image coming along every couple of minutes. In essence, the LSST sky survey will produce a 10 year “sky movie . If you think of telescopes like LBT producing a series of snapshots of selected galaxies and other celestial objects, and survey telescopes such as Sloan producing a “sky map”22, then LSST’s data stream is more analogous to producing a 10 year, frame‐by‐frame video of the sky. LSST’s Use Cases Will Involve Accessing the Catalogs LSST’s mandate includes a wide distribution of science data. Virtually anyone who wants to will be able to access the LSST database. So parts of the LSST DM software will involve use cases and user interfaces for accessing the data produced by the telescope. Those data mining parts of the software will be designed using regular use‐case‐driven ICONIX Process, but they’re not the part of the software that we’re concerned with in this book. ... a night 21 summarizes the challenge facing Jeff and Tim very nicely: The LSST websiteThe science archive will consist of 400,000 sixteen‐megapixel images per night (for 10 years), comprising 60 PB of pixel data. This enormous LSST data archive and object database enables a diverse multidisciplinary research program: astronomy & astrophysics; machine learning (data mining); exploratory data analysis; extremely large databases; scientific visualization; computational science & distributed computing; and inquiry‐based science education (using data in the classroom). Many possible scientific data mining use cases are anticipated with this database. The LSST scientific database will include: * Over 100 database tables * Image metadata consisting of 700 million rows * A source catalog with 3 trillion rows * An object catalog with 20 billion rows each with 200+ attributes * A moving object catalog with 10 million rows * A variable object catalog with 100 million rows * An alerts catalog. Alerts issued worldwide within 60 seconds. * Calibration, configuration, processing, and provenance metadata Sky Movies—Challenges of LSST Data Management The Data Management (DM) part of the LSST software is a beast of a project. LSST will deal with unprecedented data volumes. The telescope’s camera will produce a stream of individual images that are each 3.2 billion pixels, with a new image coming along every couple of minutes. In essence, the LSST sky survey will produce a 10 year “sky movie . If you think of telescopes like LBT producing a series of snapshots of selected galaxies and other celestial objects, and survey telescopes such as Sloan producing a “sky map”22, then LSST’s data stream is more analogous to producing a 10 year, frame‐by‐frame video of the sky. LSST’s Use Cases Will Involve Accessing the Catalogs LSST’s mandate includes a wide distribution of science data. Virtually anyone who wants to will be able to access the LSST database. So parts of the LSST DM software will involve use cases and user interfaces for accessing the data produced by the telescope. Those data mining parts of the software will be designed using regular use‐case‐driven ICONIX Process, but they’re not the part of the software that we’re concerned with in this book. ...
- 46
- 394
- 0
Tài liệu Truyện ngắn tiếng Anh: 2001 A Space odysey ppt
... feet and walked towards it.' It's a pity about Frank,' Hal said' Yes,' Bowman answered, after a long pause.' It is.'' He was an excellent crew member.'Finding ... died. And that's really all I can say.'She smiled pleasantly and straightened up.'Well, thank you anyway, Doctor. I'm sorry to take up your time.'' No problem at all,' ... believe or understand. 21accurately. In a way, this was as amazing as any other feature of TMA-1.Chapter 32 Life in Space Apart from quick meals in the kitchen, Bowman spent almost all his time...
- 27
- 516
- 0
Tài liệu Báo cáo khoa học: A novel dicyclodextrinyl diselenide compound with glutathione peroxidase activity ppt
... NADPHwere also obtained from Sigma. Sephadex G-25 was pur-chased from Pharmacia (Uppsala, Sweden). All the othermaterials were of analytical grade and obtained fromBeijing Chemical Plant (Beijing, ... experi-ment carried out without the mimic, ascorbate, and ferroussulfate was known as the control group.Biological analysis of mimics againstmitochondrial damageMitochondrial swelling was assayed as ... swelling and a decrease in mitochondria integrity.TBARS content in ferrous sulfate ⁄ ascorbate-treatedmitochondria was analyzed by thiobarbituric acid assay[34]. In this assay, thiobarbituric acid...
- 9
- 491
- 0
Tài liệu Báo cáo khoa học: Stimulation of poly(A) synthesis by Escherichia coli poly(A)polymerase I is correlated with Hfq binding to poly(A) tails ppt
... SequenceForward ompA* 5Â-TAATTAACCCTCACTAAAGGGGTGCTCGGCATAAGReverse ompA105 5Â-GCCATGAATATCTCCAACGAGReverse ompA117 5Â-CATCCAAAATACGCCATGAATATCForward 5ÂrpsO 5Â-TAATACGACTCACTATAGGGGCCGCTTAACGTCGCGReverse ... 5Â-GCTTCAGTACTTAGAGACForward 3ÂrpsO 5Â-TAATACGACTCACTATAGGGAGACGTAGCACGTTACACCReverse 3ÂrpsO 5Â-GAAAAAAGGGGCCACTCAGGReverse 3ÂrpsO-(T)18 5Â-T(18)GAAAAAAGGGGCCACTCAGGForward rpsO internal 5ÂGCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTGReverse ... 5ÂGCGTCGCTAATTCTTGCGAGA18TTTCAGAAAAGGGCTGReverse 3ÂrpsO-(C)18 5Â-C(18)GAAAAAAGGGGCCACTCAGGReverse 3ÂrpsO-(G)18 5Â-G(18)GAAAAAAGGGGCCACTCAGGReverse 3ÂrpsO-(N)18 5Â-GAATTGCTGCCGTCAGCTTGAForward oxyS109*...
- 10
- 488
- 0
Tài liệu Báo cáo khoa học: A novel nuclear DNA helicase with high specific activity from Pisum sativum catalytically translocates in the 3¢fi5¢ direction docx
... substrates (Fig. 5G and H) wereprepared as described previously [11,15].ATP-dependent DNA helicase and DNA-dependentATPase assaysThe standard DNA helicase reaction was performed in a 10-lL reaction ... Staschke, K .A. , Colacino, J.& Wang, Q.M. (2002) Comparative characterization of twoDEAD-box RNA helicases in superfamily II: human translation-initiation factor 4A and hepatitis C virus ... used are given at the top ofeach lane of each gel. The quantitative data are displayed on the leftside of each autoradiogram. In all gels, lane 1 (control) is the reactionwithout enzyme and lane...
- 11
- 573
- 0
Tài liệu Báo cáo khoa học: A synthetic weak neurotoxin binds with low affinity to Torpedo and chicken a7 nicotinic acetylcholine receptors docx
... first pairwas X289 (5Â TgTgCTACTTgCC CTggAA 3Â)andX191.The second pair was X133 (5Â TCC AgAAAAgATCgCAAgATg 3Â) [35] and X300 (5Â AgAgC CAAgCTTTTACTATCggTT 3Â).The PCR products were fractionated ... Electrical signals afteramplification were collected and digitized, at a sampling rateof 25 kHz, with the aid of a computer equipped with ananalogue-to-digital interface board (DT2821, Data Trans-lation, ... are clearly more similar to thosefrom cobras than to those found in kraits, mamba and coralsnake venom [4–19].Comparative analysis of Wntx sequencesFigure 2A shows a comparison of amino acid...
- 10
- 395
- 0
Tài liệu Báo cáo khoa học: "WebCAGe – A Web-Harvested Corpus Annotated with GermaNet Senses" docx
... hand-crafted sense-annotatedcorpora have been available (Agirre et al., 2007;Erk and Strapparava, 2012; Mihalcea et al., 2004),while WSD research for languages that lack thesecorpora has lagged behind ... the 3rd In-ternational Language Resources and Evaluation(LREC’02), Las Palmas, Canary Islands, pp. 609–612Santamar´ a, C., Gonzalo, J., Verdejo, F. 2003. Au-tomatic Association of Web Directories ... representative examples in Yarowsky’s ap-proach is performed completely manually and istherefore limited to the amount of data that canreasonably be annotated by hand.Leacock et al. (1998), Agirre...
- 10
- 419
- 0
Hyperspace: A Scientific Odyssey Through Parallel Universes, Time Warps, and the 10th Dimension
... Carl Friedrich Gauss, the acclaimed "Prince of Mathematicians," one of the greatest mathematicians of all time. Even today, if you ask any mathematician to rank the three most famous ... famous mathematicians in history, the names of Archimedes, Isaac New-ton, and Carl Gauss will invariably appear. Life for Riemann, however, was an endless series of setbacks and hardships, ... governs certain forms of radioactive decay. Because radioactive materials emit heat when they decay or break apart, the weak nuclear force contributes to heating the radioactive rock deep within...
- 366
- 419
- 0
Báo cáo khoa học: Serine-arginine protein kinases: a small protein kinase family with a large cellular presence potx
... (Sky1and Dsk1, respectively); Candida albicans with two(QSAA48 and QS9Q27); Aspergilus niger with nine (A2 QAE4, A2 QB94, A2 QC46, A5 AB23, A2 QWQ2, A2 QX01, A2 QX98, A2 R2M0 and A2 RSV1)]; plants with ... and 1a is nega-tively affected by interaction with scaffold attachmentfactors B1 and 2. FEBS J 276, 5212–5227.18 Nakagawa O, Arnold M, Nakagawa M, Hamada H,Shelton JM, Kusano H, Harris TM, Childs ... (2006)Targeting the RNA splicing machinery as a novel treat-ment strategy for pancreatic carcinoma. Cancer Res 66,3819–3827.57 Hishizawa M, Imada K, Sakai T, Ueda M, Hori T &Uchiyama T (2005)...
- 17
- 375
- 0
Báo cáo khoa học: The crystal structure of NlpI A prokaryotic tetratricopeptide repeat protein with a globular fold potx
... Core Facility (Yale University,New Haven, CT, USA). Primers to amplify mature NlpI(residues 20294) were 5Â-aataatccatggggagtaatacttcctggcgtaaaagtgaagtcc-3Â and 5Â-attattggatccctattgctggtccgattctgccag-3Â.3-TPR ... preceding AB pair (Fig. 1A) . LocalAB, BAÂ and nonlocal AAÂ helix packing generate anextended superhelical array with right-handed twist.The motif is often terminated by an additional A, or‘capping ... 5Â-attattggatccctattgctggtccgattctgccag-3Â.3-TPR NlpI primers (residues 62197) were 5Â-aataatccatgggggcacagcttttatatgagcgcggag-3Â and 5Â-aataatggatcctcactgttccttatccgatttttcgaagtgc-3Â. PCR products were doubly diges-ted with...
- 14
- 433
- 0
Tìm thêm: xác định các mục tiêu của chương trình xác định các nguyên tắc biên soạn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam khảo sát các chương trình đào tạo theo những bộ giáo trình tiêu biểu mở máy động cơ lồng sóc mở máy động cơ rôto dây quấn các đặc tính của động cơ điện không đồng bộ đặc tuyến hiệu suất h fi p2 đặc tuyến mômen quay m fi p2 đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng 9 tr 25