a solution of integrals of the type of glauert apos s integral
Tài liệu Company ''''A'''', corps of engineers, U.S.A., 1846-''''48, in the Mexican war doc
Ngày tải lên :
21/02/2014, 08:20
... composed of 10 sergeants, 10 corporals, 39 artificers, 39 second class privates, and musicians; all with higher pay than that of enlisted men in the line of the army Captain Swift was assigned ... reconnaissance General Scott, in his official report of the battle, says: "Lieutenant Stevens of the engineers, supported by Lieutenant G W Smith 's company of sappers and miners, of the same corps, ... was as helpless as an infant in their hands The water where they went overboard was nearly up to their necks; but when they brought the Captain to me he was as dry as whilst sitting in the boat...
- 48
- 504
- 0
Báo cáo toán học: "A solution of two-person single-suit whist" pdf
Ngày tải lên :
07/08/2014, 13:21
... This takes care of the possibility that East leads a high card Suppose therefore that East leads a card that West can beat, and that West takes the trick as cheaply as possible We have TH ≥ 2, and ... tricks, which was to be proved Case 3: East is on lead, and plays a card that West can beat In this case, we will assume that West always takes the trick (as cheaply as possible) We have already seen ... optimal for West (in the weak sense that against optimal play from East, West is guaranteed at least as many tricks as with any other strategy, although the normal strategy does not necessarily take...
- 32
- 245
- 0
A Review of David Klinghoffer’s pdf
Ngày tải lên :
15/03/2014, 14:20
... His blood’? Was it indeed so, that when God the Father was wroth with us, He saw the death of His Son for us, and was appeased towards us? Was then His Son already so far appeased towards us, ... Sunday that the climax arrives After getting the Pharisees to admit that the Messiah is the son of David, Jesus then asks them how David, under the inspiration of the Spirit, can say to the Messiah: ... the anti-Semitism taboo” because the author used the classical anti-Semitic stereotype that the Jews themselves are to blame for antiSemitism,” as well as a letter to an Austrian newspaper because...
- 39
- 409
- 0
This is a transcript of Warren Buffett''''s live interview on CNBC before appearing docx
Ngày tải lên :
28/06/2014, 17:20
... necessarily correlated with each other And — and that was — that was a fallacious model, it was held by Freddie Mac, Fannie Mae, the U .S Congress, the media, me, (LAUGH) investors, and— and home ... into various regulatory— regulations I mean, I— as a life in— we have a life insurance company It tells us— what we can in terms of BBB or in terms of A and all of that sort of thing So state after ... after state has regulations relating to insurance companies that ties in with the rating agencies And the agencies are specified And so I can't go to the XYZ rating agency and say, "Will you this...
- 7
- 325
- 0
Báo cáo toán học: "A generalization of Simion-Schmidt’s bijection for restricted permutations" doc
Ngày tải lên :
07/08/2014, 07:21
... from B the diagram squares having rank at most m − and the pairs (i, j) ∈ Om (π) Proof For any m ≥ 2, let D be the set of all diagram squares of rank at most m − The proof is based on the following ... precisely the inversions of π The case k = in Theorem gives the Wilf-equivalence of the pattern sets Am and Bm , that is, there are as many permutations in Sn which avoid every pattern of Am as ... number of diagram squares of rank at least m − In particular, π avoids all patterns of Am if and only if every diagram square is of rank at most m − the electronic journal of combinatorics 9(2) (2003),...
- 9
- 342
- 0
Báo cáo hóa học: "Research Article The Solution of Two-Point Boundary Value Problem of a Class of Duffing-Type Systems with Non-C1 Perturbation Term" pdf
Ngày tải lên :
21/06/2014, 20:20
... unique solution u0 , and u0 satisfies ∇F u0 It is also of interest to the case of A O Corollary 3.3 Let h t , g t, u , a and b be as in 2.11 Assume that there exists a real diagonalization n × n matrix ... uniqueness of solutions of some differential equations,” Journal of Mathematical Analysis and Applications, vol 322, no 2, pp 629–644, 2006 12 Boundary Value Problems H Wenhua, A minimax theorem ... for semilinear equations,” Nonlinear Analysis: Theory, Methods & Applications, vol 10, no 7, pp 651–668, 1986 H Wenhua and S Zuhe, “Two minimax theorems and the solutions of semilinear equations...
- 12
- 198
- 0
Consolidation Chareteristics based on a direct analytical solution of the Terzaghi Theory
Ngày tải lên :
21/03/2013, 14:09
... and to assess the relationship between the estimated δ p value and the selected δ ti value These estimated δ pi values are listed in Table and are also plotted against the δ ti value in Fig The ... (for an example, see Table 3), the similarity in the c v values of the proposed and Casagrande methods is observed to be associated with similarity in the δ p values Also, the discrepancy in the ... Consolidation Characteristics… Mohammed Shukri Al-Zoubi compression – square of time relationships as will be shown later in this paper Both the Casagrande and Taylor methods utilize the same theoretical...
- 9
- 402
- 0
Tài liệu Báo cáo khoa học: Crystal structure of the catalytic domain of DESC1, a new member of the type II transmembrane serine proteinase family pptx
Ngày tải lên :
19/02/2014, 00:20
... the substrates (side chains) Examination of the individual subsites S3 S2 ¢ strongly suggests that at least the structurally solved members of the four subtypes of the TTSPs will recognize largely ... differ markedly in the members of this subfamily, as shown in Fig By contrast, the S1 subsite is characterized by the conserved residues Asp189 and Ala190 of the Ala190 -type of serine proteases which ... molecular mechanisms of carcinogenesis as well as the normal biological roles of this interesting, emerging class of cell-surface proteases Structural information on the protein domains of the TTSP...
- 13
- 588
- 0
Báo cáo khoa học: A novel factor XI missense mutation (Val371Ile) in the activation loop is responsible for a case of mild type II factor XI deficiency doc
Ngày tải lên :
23/03/2014, 07:20
... hydrolysis by FXIa The Michaelis parameters, kcat and Km, were calculated on the basis of known concentration of wild -type and mutant FXIa and using the program grafit (Erithacus Software Ltd., Staines, ... with plasma FXI levels and hemorrhagic episodes are usually associated with injury or surgery, but may be so severe as to demand replacement therapy [16] The genetic basis of this rare coagulation ... is available online: Fig S1 Comparison of the catalytic properties of recombinant and plasma-derived FXIa This material is available as part of the online article from http://www.blackwell-synergy.com...
- 11
- 563
- 0
Báo cáo khoa học: Identification of a copper-repressible C-type heme protein of Methylococcus capsulatus (Bath) A member of a novel group of the bacterial di-heme cytochrome c peroxidase family of proteins docx
Ngày tải lên :
23/03/2014, 11:20
... molecular mass of 80 kDa in the SDS ⁄ PAGE analysis of the concentrate was excised from the gel and subjected to MS analyses (Fig 5C) MALDI MS ⁄ MS analyses revealed three sequenced peptides (Table ... groups are shown as sticks, and the Ca2+ ion is shown as a sphere (A) The surface of the structure is shown in transparent white Residues that are identical between the MCA2590 and CCP sequences ... membrane The extracellular localization is in accordance with the prediction of a signal peptide in a primary translation product Bioinformatical analyses revealed that SACCP shares characteristics...
- 12
- 392
- 0
Báo cáo khoa học: A pH-dependent conformational change in EspA, a component of the Escherichia coli O157:H7 type III secretion system potx
Ngày tải lên :
30/03/2014, 16:20
... spectrum for these aggregates, however, is significantly similar to the spectrum taken for the soluble EspA (Fig 5) This observation suggests that EspA has an intrinsic potential to self-associate into ... filamentous structures The data now reported suggest that EspA, at near physiological conditions, assumes short filamentous oligomers, but dissociates into partially unfolded species at acidic pH T Kato ... has a substantial amount of secondary structure throughout the pH range of 2.0–7.0 However, an analysis of 8-anilino2-naphthyl sulfonic acid (ANS) fluorescence (in the presence of EspA) suggests...
- 11
- 475
- 0
báo cáo hóa học: " A comparison of EQ-5D index scores using the UK, US, and Japan preference weights in a Thai sample with type 2 diabetes" pdf
Ngày tải lên :
18/06/2014, 19:20
... diseases (Table 8) The relative precision values suggest that the Japan weights discriminated more efficiently than the UK and US weights (the ratios of Japan versus UK and Japan versus US greater ... measurements of patients' HRQoL [3] The EQ-5D instrument consists of a five-item descriptive system of health states and a visual analog scale (VAS) Scores for the five health states can be converted ... the data and the interpretation of the results RS contributed to analyzing and collecting the data All authors have read and approved the final manuscript Acknowledgements This research was supported...
- 9
- 498
- 1
Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt
Ngày tải lên :
20/06/2014, 01:20
... sequences NS NS/5'6U NS/1 6A( 5U) NS/1 6A( 6U) AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGUAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUU AACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA ... AGCAGUAGCAAGGAGAUUUUUGAAUUAUAUAUAGCAAUACAACAGUUGAUCAUAAAAUGUGCGAUGAAUUUAAUC UGACUUUAAUUUUCUCCAGGAAUGUUG(CUA) AGCAGUAGCAAGGGGAUUUUUUCAAGGUAA(UUA) AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAA(UUA) ... AGCAGUAGCAAGAGGAUUUUUUCAUUUAAUGGAAUAACAAAAAUAUGUGCAAGUAGGAGGAAAGGGUUUAACAG CCCCUCC(UCA) AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA) AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAUUAUCCAUUUUUCAAAA UUGUCUCAA(UCA) AGCAGUAGCAAGGAGAUUUUUGAAUUAUAUAUAGCAAUACAACAGUUGAUCAUAAAAUGUGCGAUGAAUUUAAUC...
- 11
- 427
- 0
Báo cáo hóa học: " Iterative algorithms for finding a common solution of system of the set of variational inclusion problems and the set of fixed point problems" potx
Ngày tải lên :
21/06/2014, 01:20
... Nonlinear operators and nonlinear equations of evolution in Banach spaces Proc Sympos Pure Math 18, 78–81 (1976) 21 Suzuki, T: Strong convergence of Krasnoselskii and Manns type sequences for one-parameter ... nonexpansive mappings in Hilbert spaces J Math Anal Appl 318, 43–52 (2006) doi:10.1016/j.jmaa.2005.05.028 11 Zhang, SS, Lee, JHW, Chan, CK: Algorithms of common solutions for quasi variational inclusion ... doi:10.1006/ jmaa.2000.6919 13 Noor, MA, Noor, KI: Sensitivity analysis for quasi-variational inclusions J Math Anal Appl 236, 290–299 (1999) doi:10.1006/jmaa.1999.6424 14 Takahashi, W, Toyoda, M: Weak convergence...
- 16
- 309
- 0
Báo cáo toán học: "A Tur´n Type Problem Concerning the Powers of the a Degrees of a Graph" ppsx
Ngày tải lên :
07/08/2014, 06:20
... consider the case d1 ≤ 0.75n Straightforward convexity arguments, plus the fact that d1 + d2 ≤ n + and the fact that e(G) < 1.5n show that the largest possible value for the sum of squares is at ... combinatorics (2000), #R47 Put A = A \ A We claim that each v ∈ A has at most one neighbor in A Indeed, if it had two neighbors, say a0 , a1 then, as in the previous cases, we can obtain a Pk of the ... contradiction by showing that G contains a Pk We distinguish three cases Consider first the case where k is even Let (a0 , a1 ) be an edge of G [A ] By the definition of A , a1 has a neighbor in B Assume w.l.o.g...
- 14
- 269
- 0
Báo cáo vật lý: "The Hidden Property of Arrhenius-type Relationship: Viscosity as a Function of Temperature" doc
Ngày tải lên :
07/08/2014, 14:20
... Engineering Laboratories Inc., Massachusetts, USA) rotational -type viscometer was used to measure the viscosity of the oil samples Before use, the viscometer (accuracy: ± 1% full-scale range; repeatability: ... dynamic viscosity (Pa .s) ; A is the pre-exponential factor (Pa .s) ; Ea is the exponential constant that is known as activation energy (J/mol); R is the gas constant (J/mol/K) and T is the absolute ... Mrs Siti Zalaikhar, Mr Rozimi and Ms Mazalina Viscosity as a Function of Absolute Temperature 38 REFERENCES Fasina, O O & Colley, Z (2008) Viscosity and specific heat of vegetable oils as a...
- 10
- 496
- 1
Báo cáo toán học: "The number of elements in the mutation class of a quiver of type Dn Aslak Bakke Buan" pps
Ngày tải lên :
07/08/2014, 21:21
... the An case In [T] it was shown that there is a bijection between isomorphism classes of cluster-tilted algebras of type An (or equivalently isomorphism classes of quivers in the mutation class ... between the mutation class of a quiver of type Dn and the set of triangulations of a punctured n-gon up to rotations and inversion of tags See also [GLZ] We say that a diagonal from a to b is close ... to a certain class of rooted trees A tree in this class is constructed by taking a family of full binary trees T1 , , Ts such that the total number of leaves is n, and then adding a node S and...
- 23
- 300
- 0
Báo cáo lâm nghiệp: " Effects of ectomycorrhizal inoculation and the type of substrate on mycorrhization, growth and nutrition of containerised Pinus pinea L. seedlings produced in a commercial nursery" docx
Ngày tải lên :
08/08/2014, 00:22
... kept at the herbarium of the DPV-IRTA) Table I Analytical characteristics of substrates used to grow Pinus pinea seedlings in the nursery of Breda (Girona, North-Eastern Spain) Substrate parameter ... distilled water and then blended at low speed until the spores were suspended [5] For each fungus, initial spore concentration was assessed by using a haematocytometer The bulk spores suspension was diluted ... substrate These results support the importance of the characteristics of the potting substrate affecting the availability of nutrients for the fungus and its positive or negative effect on seedlings...
- 6
- 509
- 0