... building a strong middle class and a strong America EMBARGOED UNTIL DELIVERY OF THE PRESIDENT’S STATE OF THE UNION ADDRESS MAKING AMERICA A MAGNET FOR JOBS Bringing good manufacturing jobs back ... has placed our national security and our economy at risk with volatile gas prices straining the budgets of middle class families In the last four years, America has slashed our reliance on foreign ... incorporating measures of value and affordability into the existing accreditation system; or by establishing a new, alternative system of accreditation that would provide pathways for higher education...
Ngày tải lên: 08/03/2014, 06:20
... ideas by outlining a scheme for a National Deposit Bank for Parochial Savings managed and guaranteed by the government The bank would be a powerful force for social change and “unquestionably ... the same time as commercial loans, also based on personal relationships A savings bank was not primarily an independent organisation, but rather a part of local business Table 3: Percentage of ... loans against personal guarantee were small, and therefore adapted to the category of customers that savings banks intended to serve Bigger loans against personal guarantee offered savings banks...
Ngày tải lên: 29/03/2014, 08:20
Báo cáo khoa học: Human mesotrypsin exhibits restricted S1¢ subsite specificity with a strong preference for small polar side chains docx
... wild-type a1 AT SDS ⁄ PAGE analysis of complex formation confirmed that mesotrypsin covalently associated with a1 AT Pittsburgh, in a manner that was essentially identical to inhibition of cationic and anionic ... dissociate into free enzyme and inactive serpin An alternative to the inhibitory pathway is rapid deacylation of the acyl– enzyme complex, before the conformational change and protease trapping ... inactivated, with an SI of unity The second-order rate constants for complex association indicated that, after correction for SI, mesotrypsin associated with a1 AT Pittsburgh almost as rapidly as...
Ngày tải lên: 30/03/2014, 10:20
Báo cáo hóa học: " A strong convergence theorem on solving common solutions for generalized equilibrium problems and fixed-point problems in Banach space" pptx
... Appl 2008, 2008:11, (Article ID 528476) Takahashi W, Zembayashi K: Strong and weak convergence theorems for equilibrium problems and relatively nonexpansive mappings in Banach spaces Nonlinear ... problems in Banach spacesm J Inequal Appl 2010, 2010:14, (Article ID 869684) 12 Cioranescu I: Geometry of Banach spaces, Duality Mappings and Nonlinear Problems In Mathematics and Its Applications ... applications Nonlinear Anal Real World Appl 2010, 11:2963-2972 Takahashi W, Zembayashi K: Strong convergence theorem by a new hybrid method for equilibrium problems and relatively nonexpansive mappings...
Ngày tải lên: 21/06/2014, 01:20
Báo cáo hóa học: " Research Article A Strong Limit Theorem for Weighted Sums of Sequences of Negatively Dependent Random Variables" potx
... Georgia, 1993 K Joag-Dev and F Proschan, “Negative association of random variables, with applications,” The Annals of Statistics, vol 11, no 1, pp 286–295, 1983 A Bozorgnia, R F Patterson, and ... dependent random variables,” Pakistan Journal of Statistics, vol 21, no 3, pp 257–264, 2005 H R Nili Sani, M Amini, and A Bozorgnia, Strong laws for weighted sums of negative dependent random variables,” ... for their valuable comments and some helpful suggestions that improved the clarity and readability of the paper This Journal of Inequalities and Applications work was supported by the National...
Ngày tải lên: 21/06/2014, 07:20
Báo cáo hóa học: "Research Article Implementation of a Smart Antenna Base Station for Mobile WiMAX Based on OFDMA" pot
... between each antenna path and the additional antenna path with a cable The phase difference between each antenna RX path is obtained by correlating the received signal from each antenna path with ... antenna generates and transmits a test signal (2) Each RX path in the SA system receives the signal simultaneously (3) The calibration processor calculates a calibration value for each RX path ... the SA system An exact numerical analysis of the procedure is given in [11] The phase delay of the wireless path between each antenna and the additional antenna can be calculated by making a connection...
Ngày tải lên: 21/06/2014, 23:20
Báo cáo hóa học: "Research Article A Strong Convergence Theorem for a Family of Quasi-φ-Nonexpansive Mappings in a Banach Space" pdf
... Dekker, New York, NY, USA, 1996 11 Ya I Alber and S Reich, “An iterative method for solving a class of nonlinear operator equations in Banach spaces,” Panamerican Mathematical Journal, vol 4, no 2, ... Takahashi, Strong convergence theorems for nonexpansive mappings and nonexpansive semigroups,” Journal of Mathematical Analysis and Applications, vol 279, no 2, pp 372– 379, 2003 M Y Carlos and ... Kluwer Academic Publishers Group, Dordrecht, The Netherlands, 1990 W Takahashi, Nonlinear Functional Analysis, Yokohama Publishers, Yokohama, Japan, 2000 10 Ya I Alber, “Metric and generalized...
Ngày tải lên: 22/06/2014, 11:20
Building a STRONG Vocabulary : A 12 Week plan for students docx
Ngày tải lên: 26/06/2014, 23:20
Báo cáo sinh học: " Genetic vaccine for tuberculosis (pVAXhsp65) primes neonate mice for a strong immune response at the adult stage" ppt
... cDNA (2 ug) was amplified for 35 cycles at 94C for 30 seconds, 60C for 45 seconds and 72C for 1.5 minutes, using the primer pair 5'-ACC AAC GAT GGCGTG TCC AT-3' and 5'-TAG AAG GCA CAG TCG AGG-3', ... analysis Results are expressed as the mean +/- SEM for each variable Statistical analysis was performed using Minitab Version 1996 (Minitab Inc, State College, PA, USA) One-way ANOVA and the Fisher ... from animals injected with the empty plasmid DNA vector (data not shown) Also, message for -actin was detected in all evaluated samples demonstrating the suitability of RNA samples for this analysis...
Ngày tải lên: 14/08/2014, 19:22
Báo cáo y học: "Excess circulating angiopoietin-2 is a strong predictor of mortality in critically ill medical patients"
... study These data reveal an important limitation for Ang-2 as a quantitative marker for vascular permeability: high Ang-2 might be a surrogate parameter for increased capillary permeability per ... coefficient and linear regression analysis was performed after logarithmic transformation of Ang-2 values (logAng-2) The primary outcome studied was 30-day survival and was calculated from the day of ... following variables were found to be statistically significant at a 10% level in the univariate analysis and subjected to multivariate Cox regression analysis: lactate, APACHE II score, SOFA score and...
Ngày tải lên: 25/10/2012, 10:31
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... lacUV5 and trc were amplified by PCR from vectors including the relevant genes By using primers TEHA1: ACACAGATCTCTGCAGGGCACCCCAGGCTTTACA and TEHA2: ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was ... ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG were used for trc amplification The exact nucleotide sequence of each promoter region ... promoter was amplified from the vector pAff8eGFP using TEHA7: ACACCTGCAGCGATCCCGCGAAATTAATAC and TEHA8: ACACCCATGGTATATCTCCTTCT, introducing restriction sites for PstI upstream and NcoI downstream of...
Ngày tải lên: 06/03/2014, 01:20
Adapting for a Green Economy: Companies, Communities and Climate Change docx
... companies may see climate change adaptation as a case of up-front financial outlays with uncertain payoff In addition, insofar as adapting to climate change means a departure from business as usual and ... companies that are failing to analyze climate risks and to take proactive action to adapt and manage such risks, and may increase their demands or expectations for full disclosure in this area Market ... vulnerable people within the local community What is Maladaptation? Caring for Climate defines maladaptation as “an action or process that increases vulnerability to climate change-related hazards...
Ngày tải lên: 19/03/2014, 16:20
Báo cáo khoa học: Weak organic acid stress inhibits aromatic amino acid uptake by yeast, causing a strong influence of amino acid auxotrophies on the phenotypes of membrane transporter mutants ppt
... supplementation The above data reveals that a requirement for uptake of aromatic amino acids from the culture medium leads to unusually high sensitivity to weak organic acid stress An increased capacity ... reported that Azr1p, a plasma membrane transporter of the major facilitator superfamily, also confers acetate resistance [12] We therefore constructed a double Dpdr12 Dazr1 mutant (Materials and methods; ... requirements for aromatic amino acids dramatically increase sensitivity to weak organic acid stress, a sensitivity suppressed by amino acid supplementation Platings of an isogenic series of strains (haploids...
Ngày tải lên: 23/03/2014, 21:20
Less Than Zero -The Case for a Falling Price Level in a Growing Economy (Hobart Papers) docx
... well-known argument for deflation as a means for achieving an 'optimum quantity of money' is distinct from earlier arguments for falling prices As we shall see, it actually calls for deflation at a rate ... help achieve a full-information ideal for resource allocation, my argument also contradicts the claim that a variable inflation rate is the worst kind as well as the claim that an uncertain price ... how changes in the demand for real money balances based on innovations to 32 aggregate productivity are accommodated by falling prices automatically and well ahead of any possible monetary policy...
Ngày tải lên: 29/03/2014, 12:20
an oh maser flare with a strong magnetic field in w75n
... This Zeeman pair was probably overlooked by the authors, or dismissed as showing too large a velocity separation d From EVN data are really new as they are related to the flare which took place between ... close to VLA2, at a distance of 55 mas (±40 mas), or at the projected distance of 110 AU (±80 AU) Therefore, the OH masers may well be located in the same shell as the water masers The magnetic ... water masers associated with star-forming regions is typically around 100 mG, which is about the same order of magnitude as in the OH maser flare reported here The appearance of new strong maser...
Ngày tải lên: 28/04/2014, 13:15
Preparation, characterization and application of heterogeneous solid base catalyst for biodiesel production from soybean oil
... potassium loaded on alumina as a solid- base catalyst Appl Catal A- Gen 2006;300:67e74 [19] Xie W, Peng H, Chen L Calcined MgeAl hydrotalcites as solid base catalysts for methanolysis of soybean ... waste oils Unfortunately, the performances of these acid catalysts are still inferior compared with the base catalysts For this reason, a wide variety of solid bases have been examined for transesterification ... impregnation was a promising heterogeneous acid catalyst [9] Various carbohydrate-derived and a carbon-based solid acid catalyst [10,11] have good catalytic activity to high free fatty acid-containing...
Ngày tải lên: 05/05/2014, 08:42
Báo cáo sinh học: " Clearance of low levels of HCV viremia in the absence of a strong adaptive immune response" pptx
... HCV-RNA PCR has been validated and is used as a routine Table 1: Characteristics of Cases with spontaneous HCV clearance Subject # Age (Years) Risk factor Duration of IVDU (months) HLA class I Peak ... ELISPOT assays (Vienna Lab) Cryopreserved PBMC were also shipped to a second lab in Vienna headed by CK GCP-validated ELISPOT assays are performed in this laboratory on a routine bases for measuring ... hepatitis with about ten times elevated ALT levels A robust response against HCVhelicase was found in the proliferation assay at baseline and after clearance of HCV-RNA (SI values of 4.1 and 3.6, respectively)...
Ngày tải lên: 18/06/2014, 18:20