... The capital spent by the legislators at the capitol is appalling carat, caret, carrot, karat: A carat is a weight for a stone (a diamond, for instance); carat is also an alternate spelling of karat, ... aid, aide: If you help, you aid; if you have a helper or supporter, you have an aide The aid from my aide is invaluable all ready, already: If you mean all is ready, use all ready; if you mean in the past, use already ... several female graduates are alumnae; and several male graduates or several male and female graduates are alumni The short, informal form alum (or alums) can be used for any of the above Although Mary Jo and...
Ngày tải lên: 23/07/2017, 13:47
... Neurospora crassa has an intrinsic NADPH:FMN oxidoreductase activity that enables the enzyme to generate the reduced FMN cofactor (bifunctionality) The structural basis of this ‘secondary’ catalytic activity ... Table Chorismate synthase activity of the serine mutant proteins (Ser16Ala, Ser127Ala and Ser16AlaSer127Ala) in comparison with the activity of the wild-type enzyme The formation of chorismate ... histidine residues (His17 and His106), revealing their role as general acid–base catalysts [12] Recently, we reported experimental evidence that an invariant aspartate residue (Asp367) operates...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo Y học: Nuclear proteins that bind to metal response element a (MREa) in the Wilson disease gene promoter are Ku autoantigens and the Ku-80 subunit is necessary for basal transcription of the WD gene ppt
... products (base pairs) Target gene Forward primer Reverse primer Wilson gene 5¢-TGTTAAGTTTGACCCGGAAATTATC 5¢-CCGGTCAGCCAGCTGCTG 5¢-TGATGGTGGGCATGGGTCAG 5¢-TACATGGTGGTGCCGCCAGA a- actin (Perkin-Elmer ... Luciferase activity for each construct was normalized to b-gal activity, and the relative increases were calculated as the ratio of normalized activity in MREa/mutant transfected cells to that in ... (1993) Isolation and characterization of a human liver cDNA as a candidate gene for Wilson disease Biochem Biophys Res Commun 197, 271–277 Lutsenko, S & Kaplan, J.H (1995) Organization of P-type ATPases:...
Ngày tải lên: 17/03/2014, 23:20
Báo cáo khoa học: The Drosophila jumonji gene encodes a JmjC-containing nuclear protein that is required for metamorphosis pot
... exponential amplification Primer sequences used were as follows: cycD-F, 5¢-GGGATCCCA CATTGTATTCG-3¢; cycD-R, 5¢-ACGGAGCTTTGAAG CCAGTA-3¢; cycE-F, 5¢-AAGGTGCAGAAGACGCA CTT-3¢; cycE-R, 5¢-AATCACCTGCCAATCCAGAC-3¢; ... 5¢-AATCACCTGCCAATCCAGAC-3¢; cdk4-F, 5¢-TACAACAGCACCGTGGACAT-3¢; cdk4-R, 5¢-TGGGCATCGAGACTATAGGG-3¢; rp49-F, 5¢-CGG ATCGATATGCTAAGCTG-3¢; and rp49-R, 5¢-GAACG CAGGCGACCGTTGGGG-3¢ Acknowledgements ... Df(3L)AC1 animals also exhibited larval and pupal lethality and displayed similar phenotypes as homozygous djmje03131 mutants (Fig 5A and data not shown), confirming that djmje03131 is a loss...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo sinh học: " A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis" pptx
... treated with DTT and NP40 to separate the envelope fraction from the core fraction and protein from each sample was separated by SDSPAGE and detected by Western blot with anti-I7L antisera As ... an accumulation of immature viral particles, some with nucleoids, as well as the appearance of crescent shaped particles (Fig 4, panels D-F), similar to those observed by AnsarahSobrinho et al ... to be achieved before morphogenesis can proceed Taken together, the data we have presented here, as well as analysis of the VV G1L conditional lethal mutant [9], suggests a morphogenesis model...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis" potx
... treated with DTT and NP40 to separate the envelope fraction from the core fraction and protein from each sample was separated by SDSPAGE and detected by Western blot with anti-I7L antisera As ... an accumulation of immature viral particles, some with nucleoids, as well as the appearance of crescent shaped particles (Fig 4, panels D-F), similar to those observed by AnsarahSobrinho et al ... to be achieved before morphogenesis can proceed Taken together, the data we have presented here, as well as analysis of the VV G1L conditional lethal mutant [9], suggests a morphogenesis model...
Ngày tải lên: 20/06/2014, 04:20
báo cáo khoa học: " A var2 leaf variegation suppressor locus, SUPPRESSOR OF VARIEGATION3, encodes a putative chloroplast translation elongation factor that is important for chloroplast development in the cold" docx
... USA) Manipulation of nucleic acids The CTAB method was used to extract Arabidopsis leaf DNA [81], and the Trizol RNA reagent (Invitrogen, CA, USA) was used to extract total leaf RNA RNA gel analysis ... chloroplast translation, rather than to a general compromised translation Page 14 of 18 It is important to note that SVR3, as a translation elongation factor, is not expected to be a basic protein ... universally present in all prokaryotes [35], suggesting that it is probably not an essential translation factor This is consistent with our data that SVR3 is not essential for plant growth and chloroplast...
Ngày tải lên: 11/08/2014, 11:21
In order to become competent in a foreign language, it is important for language learners not only to acquire new vocabularies and a new set of phonological and syntactic rules but also to learn what Wilson (1986)
... ngữ Nam Bộ Như vậy, không gian đ a lí tiếng miền Nam, phương ngữ miền Nam hay phương ngữ Nam tác giả xác đònh rộng Không gian đ a lí phương ngữ Nam Bộ xác đònh hẹp Ranh giới PNNB trùng với ranh ... (từ thû ấy/ đến nay), thû (từ thû ấy/ đến giờ) V a rút gọn v a đảo trật tự câu nghi vấn tính chất, đặc điểm: bao cao (cao bao nhiêu), bao dai (dài bao nhiêu), bao lớn (lớn bao nhiêu)… Rút gọn, ... Long An, Tiền Giang, An -18- Giang, Kiên Giang, Cà Mau, Sóc Trăng, Bạc Liêu, Đồng Tháp, Bến Tre, Hậu Giang, Vónh Long, Trà Vinh thành phố Cần Thơ Vò trí đ a lí Nam Bộ: ph a bắc tây - bắc giáp Cam-pu-chia,...
Ngày tải lên: 17/04/2013, 16:09
A Build for Every Check-In
... Appearances The waterfall display records the name of each step in gory detail That detailed information is available from each step’s output The information presented in the waterfall display ... slave-lnx01, and source are aliases for the two hosts phytoplankton and agile buildmaster and source are aliases for phytoplankton, and slave-lnx01 is an alias for agile The names refer to the service ... install-scripts", site_bin]) As always, when you make a change, you should perform a test build Remember that the goal is ensuring build failures when a required package is missing To check this,...
Ngày tải lên: 05/10/2013, 09:20
Software Design and Development (A guide) is help you how to managed IT Project. Especially for Design and Develop software project.
... Initiation Phase Requirement Mission analysis stage Concept Dev Stage Development Phase System analysis stage System design stage Construct & acq stage User accept stage Operation and Maintenance ... individual tasks and activities that are performed in a fairly standard manner, the only difference being the objects on which they are being performed Day - Definitions & Overview Requirements Information ... What is software ? Software is computer programs that provide instructions for individual machines to function and for combinations of machines to work together Day - Definitions & Overview What...
Ngày tải lên: 15/10/2013, 23:13
Tài liệu Báo cáo khoa học: A DExD⁄ H box RNA helicase is important for K+ deprivation responses and tolerance in Arabidopsis thaliana docx
... (Invitrogen, Carlsbad, CA, USA) Quantitative real-time PCR analysis Total RNA was extracted with Trizol reagent from different tissues of Arabidopsis Contaminated DNA was removed with RNase-free DNase ... 451–458 Anderson JA, Huprikar SS, Kochian LV, Lucas WJ & Gaber RF (1992) Functional expression of a probable Arabidopsis thaliana potassium channel in Saccharomyces cerevisiae Proc Natl Acad Sci USA ... homolog, and HEN1, a novel protein, act in microRNA metabolism in Arabidopsis thaliana Curr Biol 12, 1484–1495 26 Inagaki S, Suzuki T, Ohto MA, Urawa H, Horiuchi T, Nakamura K & Morikami A (2006) Arabidopsis...
Ngày tải lên: 14/02/2014, 18:20
Tài liệu Báo cáo khoa học: Nop53p, an essential nucleolar protein that interacts with Nop17p and Nip7p, is required for pre-rRNA processing in Saccharomyces cerevisiae pdf
... anti-U3 anti-U14 anti-snR11 anti-snR37 5¢-GGTCTCTCTGCTGCCGGAAATG-3¢ 5¢-CATGGCTTAATCTTTGAGAC-3¢ 5¢-GCTCTCATGCTCTTGCCAAAAC-3¢ 5¢-CGTATCGCATTTCGCTGCGTTC-3¢ 5¢-CTCACTACCAAACAGAATGTTTGAGAAGG-3¢ 5¢-GTTCGCCTAGACGCTCTCTTC-3¢ ... 5¢-CTCACTACCAAACAGAATGTTTGAGAAGG-3¢ 5¢-GTTCGCCTAGACGCTCTCTTC-3¢ 5¢-GCCGCTTCACTCGCCGTTACTAAGGC-3¢ 5¢-ATGGGGCTCATCAACCAAGTTGG-3¢ 5¢-CTCAGACATCCTAGGAAGG-3¢ 5¢-GACGAATCGTGACTCTG-3¢ 5¢-GATAGTATTAACCACTACTG-3¢ [9] [8] [9] [9] ... between eukaryotic translation and mRNA stability A short upstream open reading frame strongly inhibits translational initiation and greatly accelerates mRNA degradation in the yeast Saccharomyces...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo khoa học: "A module that computes coordinative ellipsis for language generators that don’t" pdf
... sterben könnte and that Hans die might ‘Susi heard that Hans had an accident and might die’ • Categorial (phrasal and lexical) nodes — bolded in Fig — carry reference tags (presumably propagated from ... based on the assumption that coordinative ellipsis does not result from the application of declarative grammar rules for clause formation but from a procedural component that interacts with the ... generator and may block the overt expression of certain constituents Due to this feature, ELLEIPO can be combined, at least in principle, with various grammar formalisms However, this advantage is...
Ngày tải lên: 22/02/2014, 02:20
Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx
... encoding a putative esterase ⁄ lipase (AAC71532) and with the putative triacylglycerol lipase AAB96044 from Mycoplasma pneumoniae (Mp) Identical amino acids are indicated by an asterisk and similar amino ... PCR-amplified YOR084w (primers 5¢-GCTCTAGAATG GAACAGAACAGGTTCAAG-3¢ and 5¢-CGGAATTCCA GTTTTTGTTTAGTCGTTTTAAC-3¢) was subcloned into EcoRV-digested pBluescript SK+ (Stratagene, La Jolla, CA, USA), ... Chemicals, Darmstadt, Germany) For construction of pPC86-LPX1 and pPC97-LPX1, YOR084w was amplified using primers 5¢-CCCGGGAAT GGAACAGAACAGGTTCAAG-3¢ and 5¢-AGATCTTTA CAGTTTTTGTTTAGTCGTTTT-3¢, and...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: A DmpA-homologous protein from Pseudomonas sp. is a dipeptidase specific for b-alanyl dipeptides Hidenobu Komeda and Yasuhisa Asano docx
... L-Ala-(Gly)2 (L-Ala)2, L-Ala-D-Ala, L-Ala-D-Ala-L-Ala, DL-Ala-DL-Asn, DL-Ala-DL-Ile, DL-Ala-DL-Leu, DL-Ala-DL-Met, DL-AlaDL-Phe, DL-Ala-DL-Ser, DL-Ala-DL-Val, L-Asp-D-Ala, L-Pro-Gly, L-ProL-Phe, c-Aminobutyryl-L-His ... L-Ala-pNA D-Ala-NH2 L-Ala-NH2 D-Ala-(Gly)2 L-Ala-(Gly)2 b-Ala-L-Ala b-Ala-Gly b-Ala-NH2 b-Ala-L-His (Carnosine) b-Ala-L-Leu (b-Ala)2 similarity to that from dmpA of O anthropi LMG7991 DmpA has been ... substrate specificity of BapA and DmpA The following compounds were not substrates for BapA: (Gly)2 (Gly)3, D-Ala-Gly, D-Ala-(Gly)2 (D-Ala)2, D-Ala-L-Ala (D-Ala)3 (D-Ala)4, L-Ala-Gly, L-Ala-(Gly)2...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: "A Rose is a Roos is a Ruusu: Querying Translations for Web Image Search" pdf
... sense disambiguated, vastly multilingual dictionary called PAN D IC TIONARY (Mausam et al., 2009) PAN D IC TIONARY is automatically constructed by probabilistic inference over a graph of translations, ... dictionary is 0.9 (evaluated based on a random sample) PAN D IC TIONARY has about 80,000 senses and about 1.8 million translations at precision 0.9 We use Google Image Search as our underlying image ... translations to a set of high-coverage languages including English, French, German, Spanish, Chinese, Japanese, Arabic, Russian, Korean, Italian, and Portuguese Additionally, we include the language as well...
Ngày tải lên: 08/03/2014, 01:20
Báo cáo khoa học: A mammalian monothiol glutaredoxin, Grx3, is critical for cell cycle progression during embryogenesis doc
... the we used the forward primer 5¢-GCCGGATCCATGACTGTG GTTGAAATAAAAAG-3¢ and the reverse primer 5¢-CCGG AGCTCTTACTGTAGAGCATGTTGGAAATA-3¢ Fulllength cDNA of HsGrx3 and MmGrx3 were amplified by PCR ... specifically targeting human Grx3 sequences were purchased from SigmaAldrich The human Grx3 shRNA1 sequence is 5¢-CCG GGCTCTTTATGAAAGGAAACAACTCGAGTTGTTTC CTTTCATAAAGAGCTTTTTG-3¢ The human Grx3 shRNA2 ... sequence is 5¢-CCGGGAACGAAGTTATGGCA GAGTTCTCGAGAACTCTGCCATAACTTCGTTCTTTT TG-3¢ Control cells were transfected with a control shRNA that does not match any known human coding cDNA Stable knockdown...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: Cys126 is a completely conserved residue in triosephosphate isomerase that docx
... AGCTTTTGGTGAATCTT-3¢; C126V, 5¢-TAATTTAAAA GCCGTTGTAGTTTTTGGTGAATCTT-3¢; C126M, 5¢-T AATTTAAAAGCCGTTGTAATGTTTGGTGAATCTT-5¢; and C126T, 5¢-TAATTTAAAAGCCGTTGTAACTTTT GG TGAATCTT-3¢ Experimental procedures ... site, was 5¢-TAAT TTAAAAGCCGTGATATCTTTTGGTGAATCTT-3¢, and the primers used for generating the five mutants were: C126S, 5¢-TAATTTAAAAGCCGTTGTATCCTTTGGT GAATCTT-3¢; C12 6A, 5¢-TAATTTAAAAGCCGTTGT AGCTTTTGGTGAATCTT-3¢; ... located automatically by coot, and validated if a peak was observed above 3r on a difference map and above 1.5r on a double difference map The B-factors of all atoms were also refined, and alternative...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc
... activate it Active RPTPa-D2 is required for Src activation Materials and methods Materials and antibodies Anti-HA-tag (12CA5), anti-Src (327) Igs and anti-RPTPa (5478AP) serum were prepared as ... distinctive form of Noonan syndrome Nat Genet 39, 75–79 37 Razzaque MA, Nishizawa T, Komoike Y, Yagi H, Furutani M, Amo R, Kamisago M, Momma K, Katayama H, Nakagawa M et al (2007) Germline gain-of-function ... results indicate that catalytically active RPTPa-D2 is required for binding and activation of Src Discussion Here we report that inactivating mutations in the membrane-distal domain of RPTPa affected...
Ngày tải lên: 15/03/2014, 10:20