a signpost for the oceanic role in climate

... Harvard physicist Lisa Randall in her remarkable Warped Passages tour of hyperdimensional space and time (What space is expanding into, and what initiated the expansion, are deeply fascinating ... of the fact that nothing else about the Earth’s place in the cosmos seems “special” In fact, it is space itself that is expanding, and this means that the appearance that all is “flying away from ... greater than the acceleration they impart to Earth A careful reading of the above definition reveals that a cannonball and a feather will be accelerated by Earth’s gravity at the same rate This seems...

Ngày tải lên: 09/01/2015, 15:06

... thermal maxima of some Arkansas salamanders in relation to thermal acclimation Herpetologia 25:122–124 Seibel RV 1970 Variables affecting the critical thermal maximum of the leopard frog, Rana pipiens ... in each aquarium was monitored using a digital thermometer (0.01ЊC scale), which was calibrated against a mercury thermometer and a single channel graphical readout thermometer A 5-mm mesh plastic ... 0.5ЊC) Intraspecies variations in CTMax values were small (i.e., Ϯstandard deviation Յ 0.7ЊC) in all the species and lowest in the rainbowfish (Fig.1) The mean CTMax for the three native warm water...

Ngày tải lên: 14/03/2014, 20:20

... training for adapting new global value chains As analyzed, global value chains in Vietnam often base on cheap-salaried workers and varied other resources Participating into those chains, Vietnam has ... creating a comparative advantage At the same time there exist significant feedback effects from growth to human capital accumulation Sanchez-Paramo and Schady (2003) explain increases in wage inequality ... tertiary education (called brain drain) are present for Asia and Latin America • The emigration rate of tertiary educated workers is high particularly in Central America and the Caribbean, South...

Ngày tải lên: 23/04/2013, 11:16

... Improvements in agriculture health and medicine have produced a dramatic rise in the human population This increase in population size leads to an increase in pollution and higher demand for the world’s ... other plants are killed Sulphur dioxide will dissolve in rain producing Acid Rain • Acid rain damages trees and pollutes rivers and lakes Acid rain causes erosion of buildings and statues particularly ... water is transpired into the atmosphere Many animal and plant habitats are destroyed causing extinction of species Intensive Farming • Farming has become more intensive to provide a higher %...

Ngày tải lên: 28/09/2013, 11:10

... Improvements in agriculture health and medicine have produced a dramatic rise in the human population This increase in population size leads to an increase in pollution and higher demand for the world’s ... other plants are killed Sulphur dioxide will dissolve in rain producing Acid Rain • Acid rain damages trees and pollutes rivers and lakes Acid rain causes erosion of buildings and statues particularly ... water is transpired into the atmosphere Many animal and plant habitats are destroyed causing extinction of species Intensive Farming • Farming has become more intensive to provide a higher %...

Ngày tải lên: 26/01/2014, 10:20

... in part the anatomical residual variability As a matter of fact, inspection of the residual variance image, that partly reflects the spatial distribution of the inter-individual anatomical variability, ... contrast, the rate of GM losses appeared marginal in areas such as the lateral and medial surfaces of the superior frontal gyri, the median cingulate gyrus, and the inferior temporal gyrus Interestingly, ... Statistical analysis Volumetry TIV and GM, WM, CSF absolute and fractional volumes were analyzed using the same ANCOVA design, with bSexQ as the main factor, bAgeQ as the covariate, including a...

Ngày tải lên: 05/03/2014, 21:20

... of the proximal His and Asp residues, affecting the imidazolate character of the His, but also by the formation of a LS species The latter indicating the probable binding of His42 to the haem ... binding to a total protein concentration P, was determined, while allowing the remaining Kd and maximum absorbance change at saturation (A1 ) to oat Resonance Raman and electronic absorption spectroscopy ... 6-coordinate low spin (LS) haem species in an identical way to the wild type [16,17] The pKa for the alkaline transition being similar to that of the wild type, % 11.1 [18] Finally, comparison of the...

Ngày tải lên: 07/03/2014, 21:20

... training below) independently marked the correct alternative analyses in the ambiguous input, using mainly structural, but in some structurally unresolvable cases also higher-level, information ... probably enough to give a general indication of the nature of the analysis task with the ENGCG tag set, but a larger data would increase the reliability of the experiment In this paper, we address ... "a" ABBR NOM SG "a" DET CENTP~L ART SG 1Ms Pirkko Paljakl~ and Mr Markku Lappalainen Proceedings of EACL '99 The text was morphologically analysed using the E N G C G morphological analyser...

Ngày tải lên: 08/03/2014, 21:20

... affecting the of dry mouth and his or her age; an appropriate diagparotid glands.5,13 diminished salivary nosis is required Radiation therapy A common output Salivary disorders in the aging therapy ... in the oral and gastrointestinal environment Saliva aids in swallowing, oral cleansing, speech, digestion and taste When salivary hypofunction and xerostomia occur, transient and permanent oral ... confirm the clinical diagnosis via the observation of mycelia or pseudohyphae in a direct smear Candida may colonize the corners of the mouth extraorally (angular cheilitis) in the areas where the...

Ngày tải lên: 14/03/2014, 20:20

... pcDNA3.1-HSP70DATP-BD Antisense of pcDNA3.1-HSP70DATP-BD AAAAGGATCCAAATGGCCAAAGCCGCGGCG TCGGGTACCGGATCTACCTCCTCAATGGTG CTGATGGGGGACTCCTACGCCTTCAACATGAAGAGC GAAGGCGTAGGAGTCCCCCATCAGGATGGCCGCCTG AAAAGGATCCAAAGTCCGAGAACTGGCAGGAC ... Jiang et al McClean, VA, USA) The attenuance of formazan formed in control cells was considered as 100% viability Statistical analysis Data are expressed as the mean ± SEM of the indicated number ... compilation ª 2009 FEBS B Jiang et al The ATP-binding domain of HSP70 is important for the interaction of HSP70 with apoptosis signalregulating kinase (ASK1) and the inhibition of ASK1-induced apoptosis...

Ngày tải lên: 16/03/2014, 01:20

... different thermal treatments: (A) no annealing, (B) N2 annealing at 400 ◦ C, (C) N2 annealing at 600 ◦ C, (D) O2 annealing at 300 ◦ C and (E) O2 annealing at 500 ◦ C 300 ◦ C, carbon-containing impurities ... as-deposited films for the 600 ◦ C annealing A similar decrease in carbon content was also observed in the O2 annealing treatments: the C 1s intensity decreases with ascending O2 annealing temperature (see ... annealing at 300 ◦ C and (E) O2 annealing at 500 ◦ C In the case of N2 annealing treatment, the intensity of C 1s peak begins to decrease considerably at 600 ◦ C under the condition of maintaining...

Ngày tải lên: 20/03/2014, 13:11

... yielded statistically significant increases in the ECS The effect was apparent for marijuana smoking, 31 TABLE The effects of cannabis and natural cannabinoids as clastogens* in other than human lymphocyte ... unfractionated marijuana extracts, psychoactive and nonpsychoactive components of marijuana, natural and synthetic cannabinoids, and cannabinoid metabolites as well as other abused substances, individually ... Collect and systematically classify the findings of all intramural and extramural research supported by the hational institute on Drug Abuse (NIDA); Evaluate the findings in selected areas of particular...

Ngày tải lên: 22/03/2014, 12:20

... Persian transliteration During a training phase, both methods derive rules for transforming character combinations (segments) in the source language into character combinations in the target language ... their familiarity with Arabic should be in the second rank after English All of the participants held at least a Bachelors degree Table summarizes the information about the transliterators and their ... be taken into account Yaser Al-Onaizan and Kevin Knight 2002 Machine transliteration of names in Arabic text In Proceedings of the ACL02 workshop on Computational approaches to semitic languages,...

Ngày tải lên: 23/03/2014, 18:20

... whereas the separate values for V a and V b were calculated using the ratio of the areas max max taken from the integrated HPLC chromatogram analysis Additional data and discussion about this kinetic ... of the peptide containing Ala with TOP was not linear in all studied range of temperature (Fig 1A) The Eyring plots obtained for neurolysin reactions with the peptides containing Ala and Ile at ... and Ile at the X position in the series AbzGGFLRRXQ-EDDnp was examined in the salt concentration range 00.5 M, and the data are presented in Table The kcat/Km values increased with the increasing...

Ngày tải lên: 23/03/2014, 21:21

... tertiary interactions that they establish in the intact proteins Therefore, the assessed conformational trends of isolated fragments are the same as those occurring in the protein chain during the ... Reinhardt S & Hankein T (2000) A vertebrate globin expressed in the brain Nature 407, 520–523 Kawada N, Kristensen DB, Asahina K, Nakatani K, Minamiyama Y, Seki S & Yoshizato K (2001) Characterization ... to analyse protein folding pathways [28] As fragments cannot develop the long-range interactions of native proteins that usually form along the folding pathway of the whole protein chain, the...

Ngày tải lên: 30/03/2014, 01:20

... Nagayama, Y., Namba, M., Yokoyama, N., Yamashita, S & Niwa, M (1998) Role of asparagine-linked oligosaccharides in protein folding, membrane targeting, and thyrotropin and autoantibody binding ... le Cancer We thank G Vassart and S Costagliola for kindly providing the TSHR-pcDNA3 and TSHRK562 cell line, P Banga for the mAb A1 0, M Michalak for the CRT cDNA, D.Y Thomas for CNX cDNA and A. J ... incubated for h at °C with protein A- Sepharose and centrifuged for at 10 000 g The supernatant was incubated for h at °C with mAb A1 0, and after 25 lL of protein A- Sepharose had been added, it then...

Ngày tải lên: 31/03/2014, 08:20

... electron and the hole increases, and therefore the Coulomb interaction decreases, as the energy of the quantum state increases The final result is a blue-shift of the OR and SHG peaks of the order ... cm-3 [8] In Figure 1, we plot the characteristic lengths and energies for the confined particle in a GaAs/AlGaAs quantum dot as a function of the confinement frequency ω0 a and R∗ are independent ... Characteristic (a) lengths and (b) energies for the confined particle in a GaAs/AlGaAs quantum dot as a function of the confinement frequency The red (black) lines correspond to L and ħω0 (a and...

Ngày tải lên: 21/06/2014, 04:20

... three Page of temperatures are similar For a specified diameter, the relative viscosity increases with increasing temperature, and the increasing extent nonlinearly varies with the diameter of ... could vary with the temperature This finding provides an insight into the researches on the nanoflows and is instructive for understanding the coupling effect of the size and the temperature at the ... dramatically increases with the diameter For the diameter varying from 10.5 to 14.5 Å, the relative viscosity is in a transition state from the sharp variation to a smooth region (see the transition...

Ngày tải lên: 21/06/2014, 06:20

... nanocrystals and grain boundaries Taking advantage of the large lateral resolution of the CAFM, a more detailed analysis has been performed to explore this point Toward this aim, the areas with smaller ... indicates an increase of the surface roughness after polycrystallization, in agreement with [11,22] Finally, since a thermal annealing process can also affect the thickness of the layers of the ... crystals and grain boundaries can be observed, and so trapping is randomly distributed in the gate area Finally, the impact of breakdown (BD) was also investigated on polycrystalline and amorphous...

Ngày tải lên: 21/06/2014, 06:20

... assume that {1, 2, 3, 6} ∈ TX1 ∪X2 ∪X3 and that the pair {3, 4} appears in a block containing {1}, so without loss of generality we can share the blocks of TX1 ∪X2 ∪X3 in the following way: the electronic ... blocks are at the same time C-edges and D-edges [8] In [8, 9, 10] the necessary conditions for the existence of strict colourings for BSQSs were determined and the exact value of the upper chromatic ... set A D-hypergraph is a classical hypergraph [1] and its lower chromatic number is the chromatic number introduced by Erd˝s and Hajnal in 1966 [3] o In this paper the concepts of strict colouring...

Ngày tải lên: 07/08/2014, 06:22