a short course in project management

microsoft office system 2003 edition inside out (2004)

microsoft office system 2003 edition inside out (2004)

... or interrelated data and to divide data into separate, related tables to maximize storage efficiency and simplify data maintenance ● Publish an interactive form on an intranet that allows users ... update information from a database ● Store XML data in a database table, or export data to an XML document ● Create entire Web sites using templates or wizards—such as a site for establishing a ... Tasks Chapter Task ● Organize, calculate, analyze, chart, and save numeric business or personal data in a spreadsheet (row and column) format; for example, balance checking accounts, prepare invoices,...

Ngày tải lên: 26/10/2014, 20:46

1,5K 2K 0
Command-Line Editing and History

Command-Line Editing and History

... function that has been extremely valuable to me is the ability to search for previous commands that match a pattern You this search in the same way as a search in a vi session First you press Escape ... One additional option, available in both shells, that increases your efficiency at the command line is command and file completion With this feature, you can start to type a path or command, and ... more standard tool and is available on all systems If you’re a fan of emacs and comfortable with that editor, then by all means use the emacs mode The goal here is to become quicker and more efficient...

Ngày tải lên: 05/10/2013, 08:51

3 300 0
Lab 4.1.4 Copying, Editing, and Pasting Configurations

Lab 4.1.4 Copying, Editing, and Pasting Configurations

... combinations of interfaces in the device This interface chart does not include any other type of interface even though a specific router may contain one An example of this might be an ISDN BRI interface ... a Configured the routers according to the information in the table above in order for CDP to be able to collect information about them Refer to prior labs on configuring Serial and Ethernet interfaces ... ISDN BRI interface The string in parenthesis is the legal abbreviation that can be used in IOS command to represent the interface 4-4 CCNA 2: Routers and Routing Basics v 3.0 - Lab 4.1.4 Copyright...

Ngày tải lên: 05/11/2013, 12:15

4 360 0
Tài liệu Adding, Updating, and Deleting Related Rows In this section, you''''ll learn how to make changes in docx

Tài liệu Adding, Updating, and Deleting Related Rows In this section, you''''ll learn how to make changes in docx

... program contains a method named SetupOrdersDA() that performs the previous code Creating and Populating a DataSet Next, the following example creates and populates a DataSet named myDataSet with ... Earlier in the section "Examining the Constraints Created by the DataRelation," you saw that a ForeignKeyConstraint is added to the child DataTable by default when a DataRelation object is added ... ModifyingRelatedData.cs program contains a method named PushChangesToDatabase() that uses the previous code One thing you'll notice about ModifyingRelatedData.cs is that it calls PushChangesToDatabase()...

Ngày tải lên: 24/12/2013, 01:17

10 409 0
Tài liệu Text Editing and File Management ppt

Tài liệu Text Editing and File Management ppt

... contents on the right windowpane As with most things in Windows, there is more than one way to rename a file The more conventional way to rename a file is to select the file by clicking on it once Then, ... to rename the file back to the original name “testfile.txt” Both methods work equally well It is a matter of personal preference as to which way is used Step Insert a formatted floppy disk into ... verify that it was moved, navigate Windows Explorer back to the My Documents folder to make sure that the file is not there anymore Then navigate back to the floppy and make sure that the document...

Ngày tải lên: 18/01/2014, 05:20

3 355 0
Tài liệu Lab 3.2.9 Copying, Editing, and Pasting Configurations pdf

Tài liệu Lab 3.2.9 Copying, Editing, and Pasting Configurations pdf

... combinations of interfaces in the device This interface chart does not include any other type of interface even though a specific router may contain one An example of this might be an ISDN BRI interface ... configuration by clicking on File > Save and exit Notepad Step 11 Test the backup configuration a Any form of backup that has not been tested could be a liability in a failure situation This includes ... hostname as shown in the chart Configure the console, virtual terminal and enable passwords Step Configure the interfaces and routing protocol on the Birmingham router a Go to the proper command...

Ngày tải lên: 24/01/2014, 19:20

7 404 0
Tài liệu Lab 3.2.9 Copying, Editing, and Pasting Configurations doc

Tài liệu Lab 3.2.9 Copying, Editing, and Pasting Configurations doc

... combinations of interfaces in the device This interface chart does not include any other type of interface even though a specific router may contain one An example of this might be an ISDN BRI interface ... clean version of the configuration by clicking on File/Save and exit Notepad Step 11 Test the backup configuration a Any form of backup that has not been tested could be a liability in a failure ... command copy start run at the router prompt Step 14 Verify that the internetwork is functioning again ping the FastEthernet interface of the other router a Use the command reload command to restart...

Ngày tải lên: 24/01/2014, 19:20

7 340 0
Tài liệu Editing and Updating Data in a Web Forms DataGrid pdf

Tài liệu Editing and Updating Data in a Web Forms DataGrid pdf

... dataGrid.DataSource = CreateDataSource( ); dataGrid.DataKeyField = "Id"; dataGrid.DataBind( ); } private DataTable CreateDataSource( ) { DataTable dt = new DataTable(TABLENAME); // Create the DataAdapter ... Create a DataAdapter for the update SqlDataAdapter da = new SqlDataAdapter("SELECT * FROM " + TABLENAME + " ORDER BY Id", ConfigurationSettings.AppSettings["DataConnectString"]); // Create a CommandBuilder ... Session variable to cache the data source for the DataGrid UpdateDataSource( ) This method creates a DataAdapter and uses it with updating logic generated by a CommandBuilder to update the data source...

Ngày tải lên: 26/01/2014, 10:20

10 387 0
high definition postproduction editing and delivering hd video

high definition postproduction editing and delivering hd video

... Square Square Square Square Square Square Rectangular Rectangular Rectangular Rectangular Rectangular Rectangular Square Square Square Rectangular Rectangular Square Progressive Progressive Interlaced ... acceptance of and interest in HD has increased tremendously Add to that the exciting advances in nonlinear editors, HDV cameras, playback decks, and tapeless recording cameras, it's clear that HD ... The ATSC table only includes the formats that are available to broadcasters for OTA broadcasting In comparison, NTSC is a specific process of broadcasting a composite signal NTSC is broadcast as...

Ngày tải lên: 01/06/2014, 09:12

249 223 0
Sample Candidite Writing Scripts and Examiner Comments

Sample Candidite Writing Scripts and Examiner Comments

... some  information  missing  and  the  information  is  inaccurate  in minor  areas.  The  answer  flows  quite  smoothly  although  connectives are overused or inappropriate, and some of the points do not link up well. The grammatical accuracy is quite good and  ... of words and whilst there is good structural control, the complexity and variation in the sentences are limited Academic Writing Sample Task 1B  Sample Script A Examiner comment  Band 6  The  answer  ... form and spelling which interfere slightly with the flow of the answer Academic Writing Sample Task 1B  Sample Script B  Examiner comment  Band 7  The answer deals well with both the individual media trends and the overall comparison of these trends. The opening could be more ...

Ngày tải lên: 20/05/2015, 10:31

12 235 0
Functional diversity of cav1 3 channels generated by RNA editing and alternative splicing

Functional diversity of cav1 3 channels generated by RNA editing and alternative splicing

... ATTCTGAAGCAATTCaGTTTTAGGGTGGTGG-3’; M2 reverse: 5’- CCACCACCCTAAAACtGAATTGCTTCAGAAT-3’ M3 forward: 5’- CAGAATATTCTGAAGTAATTCTGTTTTAGGGT-3’; M3 reverse: 5’- ACCCTAAAACAGAATTACTTCAGAATATTCTG-3’ Transfection ... 5’-TGTGGGAAGTTGTCGAAGGTGCTTCGCTTGGTTTGCATTTCATCAAAAGT AACAGCATAATCAGGAACATCATAAGGATA -3’; Subsequently the HA oligo was joined to two DNA fragments upstream and downstream of the point of insertion ... Comparison of sequence differences between exon and 8a, exon 31 and 3 1a of CaV1.3 channels   vi ABBREVIATIONS ADAR adenosine deaminase acting on RNA AID alpha interacting domain AMPAR α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic...

Ngày tải lên: 10/09/2015, 08:26

119 302 0
Functional characterization of RNA editing and alternative splicing in the carboxyl terminus of cav 1 3 calcium channel

Functional characterization of RNA editing and alternative splicing in the carboxyl terminus of cav 1 3 calcium channel

... CTGTGTCTCATCGAAATTGAACTT Sense HA-tag-overlap-F CGGAGGGAAGTTCAATTTCG Anti-sense HA-tag-overlap-F TGTGGGAAGTTGTCGAAGGT Sense HA-tag-oligo-F CGGAGGGAAGTTCAATTTCGATGAGACAC Ta (°C) 58 58 AGACTCGTCATTATCCTTATGATGTTCCTG ... AGACTCGTCATTATCCTTATGATGTTCCTG ATTATGCTGTTACTTTTGATG Anti-sense HA-tag-oligo-R TGTGGGAAGTTGTCGAAGGTGCTTCGCTT 58 GGTTTGCATTTCATCAAAAGTAACAGCAT AATCAGGAACATCATAAGGATA Hippocampal neuron culture and transfection ... localization of HA-tagged CaV1.342, CaV1.34 2a and splice variants Δ41, 43i, Δ44 and 4 8a- in hippocampal neurons x    ABBREVIATIONS a. a amino acids ADAR adenosine deaminase acting on RNA BLAST basic...

Ngày tải lên: 10/09/2015, 15:48

174 400 0
The Technique of Film and Video Editing  5th Edition

The Technique of Film and Video Editing 5th Edition

... in France and 10 years later in North America It is a widely held view today The book, which was updated in 1968 by Gavin Millar (now also a director), remains as widely read today as it was when ... editing process The new chapters are about editing for narrative clarity, editing for dramatic emphasis, editing for subtext, and editing for aesthetic purpose All chapters take a case study approach ... implications are a basic assumption of this book THE ROLE OF EXPERIMENTAL AND DOCUMENTARY FILMS Although the early innovations in film occurred in mainstream commercial movies, many innovations also...

Ngày tải lên: 14/08/2013, 14:41

486 825 1
Creating and Editing Files

Creating and Editing Files

... can create a new template by copying an existing template and then clicking Edit For example, if you want to create a new Java class template, you can duplicate an existing Java class template, ... generate a variety of code, including the following: ■ ■ ■ ■ Fill in the names of classes and class members, as well as any necessary import statement Browse Javadoc documentation of available classes ... Converts an anonymous inner class to a named inner class Working With Import Statements In the IDE, there are several ways to help you make sure that your Java class has all the necessary import statements:...

Ngày tải lên: 03/10/2013, 03:20

14 340 0
21 STUPIDLY SIMPLE WAYS TO GET MORE LIKES AND COMMENTS ON YOUR FACEBOOK PAGE

21 STUPIDLY SIMPLE WAYS TO GET MORE LIKES AND COMMENTS ON YOUR FACEBOOK PAGE

... function in the same way that gravity or karma functions Here are a few: • The Law Of In uence: You learn about interesting Facebook Pages when your friends interactions with that Page show up in your ... COMMENTS Ask those who attended the event to share a favorite moment – If you’re a national organization that held an event in Chicago, you can target wall update to fans living in Chicago (see ... respondents saw a signifi- cant increase in traffic to their websites because of their Facebook presence ➡ About 66 percent of respondents from advocacy organizations saw an increase in people taking some...

Ngày tải lên: 19/10/2013, 19:16

29 584 1
Viewing a WSDL File and Testing a Web Service

Viewing a WSDL File and Testing a Web Service

... method to return a DataSet with a DataTable containing all the rows from the Customers table (see Figure 17.6) Notice that the space characters in the whereClause parameter value have been converted ... whereClause, the RetrieveCustomers() method returns a DataSet with a DataTable containing the one row from the Customers table with a CustomerID of ALFKI, as shown in Figure 17.5 Notice that the ... type="s0:CustomersSoap">

Ngày tải lên: 24/10/2013, 12:15

7 382 0
Evaluating What You’ve Written—Revising and Editing

Evaluating What You’ve Written—Revising and Editing

... the reader the main idea of the paragraph All the other sentences in the paragraph should relate to that main idea A paragraph that does this is said to be focused It has one main idea How can you ... Capital can also mean something that is important or that is punishable by death Rape is a capital crime John proposed a capital idea! Everyday means “ordinary or usual.” Every day means “each ... surface.” Plain can also mean a flat piece of land The plane landed on time Please tell me again in plain English Buffalo used to live on the plains Principal means “head of a school or Principle...

Ngày tải lên: 25/10/2013, 17:20

46 525 0
Spreading Timeshifted TV Watching and Expanding Online-Video Viewing

Spreading Timeshifted TV Watching and Expanding Online-Video Viewing

... disseminate analog information ("I write letters to television stations, newspapers and magazines") and place a monetary value on information ("it is natural to pay money for information") Regarding ... Digital terrestrial I can watch broadcasts Digital Satellite broadcasts I can watch digital DSB bro adcasts I can watch analog DSB I have no DSB access One-seg awareness I have heard of one-seg ... services We have investigated the relationship between terrestrial broadcasting (digital or analog) and DSB services (digital, analog or no access), and produced a graph with possible combinations...

Ngày tải lên: 01/11/2013, 14:44

39 404 0
Tài liệu Creating and Editing Email docx

Tài liệu Creating and Editing Email docx

... editor or save existing messages as stationery using File, Save As and choosing HTML Sending messages with stationery can result in very large email messages Avoid using stationery when you email people ... Start with a Blank Signature and choose Next (see Figure 5.10) Figure 5.10 Create your signature using a blank signature, an existing signature as a template, or an existing file as a template ... Assign a signature to each account and to new mail and replies, even if it's only a blank signature and you'll be able to take full advantage of Outlook's signature handling features When you create...

Ngày tải lên: 21/01/2014, 02:20

9 258 0
w