a servo motor with a flexiforce sensor

báo cáo hóa học: " Human-robot cooperative movement training: Learning a novel sensory motor transformation during walking with robotic assistance-as-needed" doc

báo cáo hóa học: " Human-robot cooperative movement training: Learning a novel sensory motor transformation during walking with robotic assistance-as-needed" doc

... conventional joystick and the TheraJoy device in both the horizontal and vertical configurations, each within multiple areas of the arm workspace Data and statistical analysis The data was analyzed across ... [31] and Reinkensmeyer [32] used games and simple or commercial hardware to assess and motivate arm use Our approach also uses commercially available, gamebased activities and custom assessment activities ... defined in Table 2: the Movement Speed metric These data have been analyzed with the special attention paid to validate hypotheses and Mean and standard deviation values are calculated and presented...

Ngày tải lên: 19/06/2014, 10:20

17 385 0
báo cáo hóa học: " Human-robot cooperative movement training: Learning a novel sensory motor transformation during walking with robotic assistance-as-needed" ppt

báo cáo hóa học: " Human-robot cooperative movement training: Learning a novel sensory motor transformation during walking with robotic assistance-as-needed" ppt

... relax its assistance at a rate faster than the human motor system learns to decrement its own force That is, the robot must adapt its performance to the learning human faster than the human adapts ... Creating a Virtual Impairment and for Assisting in Motor Learning Experimental Apparatus for Creating a Virtual Impairment and for Assisting in Motor Learning Picture (left) and diagram (right) ... experimental setup The robot makes use of a linear motor with two forcer coils and a V-shaped linkage to accommodate and drive motion of the robot's apex in the parasagittal plane The apex is attached...

Ngày tải lên: 19/06/2014, 10:20

16 238 0
Báo cáo hóa học: " Minimum Energy Decentralized Estimation in a Wireless Sensor Network with Correlated Sensor Noises" pot

Báo cáo hóa học: " Minimum Energy Decentralized Estimation in a Wireless Sensor Network with Correlated Sensor Noises" pot

... serving as an Associate Editor for several international journals including SIAM Journal on Optimization, Mathematical Programming, Mathematics of Computation, and Mathematics of Operations Research ... supported in part by the Natural Sciences and Engineering Research Council of Canada, Grant no OPG0090391, by the Canada Research Chair Program, and by the National Science Foundation, Grant no DMS0312416 ... such a way that sensors within each group are placed relatively close to each other and far from the rest of the sensors Thus, sensor observations are uncorrelated unless they are generated from...

Ngày tải lên: 23/06/2014, 00:20

10 197 0
Direct torque and indirect flux control of brushless DC motor with non sinusoidal back EMF without position sensor

Direct torque and indirect flux control of brushless DC motor with non sinusoidal back EMF without position sensor

... sβ  (8) If sampling period is significantly less than electrical and mechanical time constant then back-EMF value can be assumed to remain constant During each sampling period and so: deα / ... flux-linkage vector are obtained from the measured stator voltages Vsα and Vsβ and currents i sα and isβ , then by using (1) and (4) qand d-axis flux linkage are drived Also, by usig (4) qand d-axis ... frame are not constant, therefore current wave shapes require very fast controllers in particular at high speed Classical bandwidth of the controller (such as proportional– integral) does not allow...

Ngày tải lên: 03/01/2014, 19:45

5 618 2
Tài liệu A WIRELESS SENSOR NETWORK AIR POLLUTION MONITORING SYSTEM pdf

Tài liệu A WIRELESS SENSOR NETWORK AIR POLLUTION MONITORING SYSTEM pdf

... database • Data Displayer: This extracts data as required by the user and displays them in a table as well as evaluates the AQI for the selected area • Trend Analyser: Gets previous readings and ... java DriverManager allows for a method to open a database, providing it the name of the database, user name and password as parameters So, this component just has to make a call to this method and ... Collaboration among thousands of nodes to collect readings and transmit them to a gateway, all the while minimizing the amount of duplicates and invalid values Use of appropriate data aggregation...

Ngày tải lên: 17/02/2014, 22:20

15 365 1
Báo cáo hóa học: " Weak reverse Hölder inequality of weakly A-harmonic sensors and Hölder continuity of A-harmonic sensors" potx

Báo cáo hóa học: " Weak reverse Hölder inequality of weakly A-harmonic sensors and Hölder continuity of A-harmonic sensors" potx

... for each Wang and Bao Journal of Inequalities and Applications 2011, 2011:99 http://www.journalofinequalitiesandapplications.com/content/2011/1/99 Page of 10 holds, then for all a1 , a2 Î D, d (a1 , ... C (a1 )dα inf γ∈ γ (2:11) Wang and Bao Journal of Inequalities and Applications 2011, 2011:99 http://www.journalofinequalitiesandapplications.com/content/2011/1/99 Page of 10 for all a2 Î D with ... Hölder inequality of weakly A- harmonic sensors and Hölder continuity of A- harmonic sensors Journal of Inequalities and Applications 2011 2011:99 Submit your manuscript to a journal and benefit...

Ngày tải lên: 20/06/2014, 22:20

10 231 0
Báo cáo hóa học: " Research Article A Wireless Sensor Network for RF-Based Indoor Localization" pptx

Báo cáo hóa học: " Research Article A Wireless Sensor Network for RF-Based Indoor Localization" pptx

... Processing a separate channel, their operation is not a ected Thus, LocMAC base does not dictate the usage of LocMAC relay LocMAC relay provides localization data aggregation and low-latency data relay ... Channel access Relay network data exchanges can be divided into intracluster aggregation data exchanges and to relay data exchanges The aggregation data exchanges occur between ACHs and their ... time passed between the 3.1.3 Data transfer LocMAC base enables low-rate data exchanges between location nodes and anchor nodes Both LBs and LBAs include payload parts Uplink data can be piggybagged...

Ngày tải lên: 21/06/2014, 22:20

27 411 0
Báo cáo hóa học: " A pH sensor based on electric properties of nanotubes on a glass substrate" pptx

Báo cáo hóa học: " A pH sensor based on electric properties of nanotubes on a glass substrate" pptx

... Inc., Japan Cover glass was purchased from Matsunami Glass Ind., Ltd., Japan A photoresist (OFPR-800) was purchased from Tokyo Ohka Kogyo Co., Ltd., Japan CNT immobilization on glass Fabrication ... Bangsaruntip, E Yenilmez, X Tang, Q Wang, Y.-L Chang, H Dai, J Am Chem Soc 126, 1563 (2004) S Takeda, A Sbagyo, Y Sakoda, A Ishii, M Sawamura, K Sueoka, H Kida, K Mukasa, K Matsumoto, Biosens Bioelectron ... to fabricate a nanotube device on a cover glass and to investigate its applications Regarding the fabrication process of the nanotube FET sensor, chemical vapor deposition (CVD) method has been...

Ngày tải lên: 22/06/2014, 18:20

6 346 0
Báo cáo hóa học: " A Two-Sensor Noise Reduction System: Applications for Hands-Free Car Kit" ppt

Báo cáo hóa học: " A Two-Sensor Noise Reduction System: Applications for Hands-Free Car Kit" ppt

... Concerning the two -sensor algorithms, the performance appear to be quite comparable The reason is that continuous noise updating does not provide any clear advantage; the noise variations, mainly due ... indices are computed on manually segmented speech frames, then averaged on all frames to give a global measure per condition (stationary/nonstationary) Consider Figures 10 and 11 displaying the ... enhancer usually has to cope with cocktail-party effect (many disturbances with point-shaped sources) and with diffuse noises, which are poorly removed with the previous approach Maj et al [14] proposed...

Ngày tải lên: 23/06/2014, 01:20

10 225 0
Báo cáo hóa học: " Preprocessing in a Tiered Sensor Network for Habitat Monitoring" doc

Báo cáo hóa học: " Preprocessing in a Tiered Sensor Network for Habitat Monitoring" doc

... off-line data mining and analysis It is feasible to transmit data sampled at those relatively low rates all the way back without local processing However, in our application context, it is not feasible ... to transmit all the data back due to the higher sampling rate For a network of 1000 sensor nodes that sample acoustic signal at 20 kHz with a sample size of 16 bits, the data generation rate is ... beyond the capability of the system A sampling rate of 22 kHz with a sample size of bits will generate data at a rate higher than three times of what a micronode’s 50-Kbps radio can transmit Moreover,...

Ngày tải lên: 23/06/2014, 01:20

10 300 0
Báo cáo y học: "A pathway sensor for genome-wide screens of intracellular proteolytic cleavage" ppt

Báo cáo y học: "A pathway sensor for genome-wide screens of intracellular proteolytic cleavage" ppt

... HindIII and NotI sites in pEAK12 using primers 5'GACAAGCTTATGGATGATGATATCGCC-3' and 5'-GACGCGGCCGCTTAGAATTCGAAGCATTTGCGGTG-3' dNGLUC was amplified by PCR using primers 5'-GACGAATTCATGCTAGCCAAGCCCACCG-3' ... 5'AATTGGACGAGGTGGACGGCGACGAGGTGGACGGCGACTACAAGGACGA CGACGACAAGGAATTCGC-3' and 5'GGCCGCGAATTCCTTGTCGTCGTCGTCCTTGTAGTCGCCGTCCACCTCGTC GCCGTCCACCTCGTCC-3' to generate pEAK12-Actin-DEVDG2flag-dNGLUC ... full-length Actin-LC3-dN is marked with an asterisk, the cleavage product is marked with an arrowhead Figure shRNA targeting AKT1 enhances autophagy shRNA targeting AKT1 enhances autophagy (a) shRNA targeting...

Ngày tải lên: 14/08/2014, 08:21

11 278 0
SOCIAL INTERACTION ANALYSIS USING a MULTI SENSOR APPROACH

SOCIAL INTERACTION ANALYSIS USING a MULTI SENSOR APPROACH

... 113 Average classification accuracy on body language category 114 Average classification accuracy on speaker’s attention concept114 Average classification accuracy on audience’s engagement ... computational component [Hummon and Fararo, 1995] Advanced computational systems enable a variety of techniques to collect, manage and analyze this vast array of information, to address important ... wearable sensors 1.1.1 Social Interaction Analysis with Ambient Sensors Traditional social interaction analysis work makes use of the existing facilities such as the web cameras and surveillance...

Ngày tải lên: 08/09/2015, 15:34

161 348 0
A multi sensor approach for reverse engineering of an object

A multi sensor approach for reverse engineering of an object

... scan is estimated to select subsequent gazes for the subsequent gazes for the laser scanner A disadvantage is that the first scan is made manually and each additional scan is made after calculations ... generated from the scanned data Reverse engineering can also be used as means to archive their outdated design data to obtain a database of their products This is done to repair and maintain facilities ... accuracy of the scanning result is not as accurate as the contact digitizer Laser range sensors tend to generate very large data files, unstructured data that is not arranged in an orderly fashion...

Ngày tải lên: 16/09/2015, 14:04

110 304 0
SOCIAL INTERACTION ANALYSIS USING a MULTI SENSOR APPROACH

SOCIAL INTERACTION ANALYSIS USING a MULTI SENSOR APPROACH

... 113 Average classification accuracy on body language category 114 Average classification accuracy on speaker’s attention concept114 Average classification accuracy on audience’s engagement ... enable novel and important applications for research in wearable computing The recent and widespread availability of a number of appealing wearable cameras, such as Google Glass and GoPro cameras, ... wearable sensors 1.1.1 Social Interaction Analysis with Ambient Sensors Traditional social interaction analysis work makes use of the existing facilities such as the web cameras and surveillance...

Ngày tải lên: 30/09/2015, 09:22

161 357 0
Direct torque control of brushless DC motor with non sinusoidal back EMF

Direct torque control of brushless DC motor with non sinusoidal back EMF

... that of ation, toril da d becaseao bius lhsepolm re bcauseof teReference a hefa-axisdstatorc(b flux ol hanges at everyncmmutaation ptaoints an curve shap a n v g Tiplitabe is betwee theng han afluaxei ... the phase inductance, motor speed, snubber circuit, and the amount of load torque If a BLDC motor has an ideal trapezoidal back-EMF having a 120 electrical degree flat top, one current sensor ... Hall-3 and inductance, respectively, the a, B-axes rotor flux linkages qJrac and Ypr/ are obtained by taking the integral of both sides of Fig Actual and ideal (dashed-line) stator flux linkage...

Ngày tải lên: 03/01/2014, 19:44

7 457 3
Direct torque control of four switch brushless DC motor with non sinusoidal back EMF

Direct torque control of four switch brushless DC motor with non sinusoidal back EMF

... openphase back-EMF causes each straight side of the ideal hexagonal shape of the stator flux linkage locus to be curved and the actual stator flux linkage trajectory tends to be more circular in ... signals at S1 (or S2) and S4 (or S3) should be created individually making additional voltage vectors V0 and V7 which act as a zero voltage vector at Sectors and in four-switch DTC of a BLDC motor ... automatically shaped to obtain the desired electromagnetic torque characteristics using (1) When the actual stationary reference frame back-EMF constant waveforms from the pre-stored look-up table...

Ngày tải lên: 03/01/2014, 19:46

7 617 1
The Impact of Spatial Correlationon Routing with Compressionin Wireless Sensor Networks

The Impact of Spatial Correlationon Routing with Compressionin Wireless Sensor Networks

... transmission cost data1 data2 data3 data4 data5 data6 2.4 9000 correlation parameter in log scale x 10 2.5 6000 2000 1000 2.6 data1 data2 data3 data4 data5 data6 11000 tranmission cost transmisssion ... to calculate approximately the total amount of uncorrelated data generated by a set of n nodes From Equation 2, it appears that on average, each new source contributes an amount of uncorrelated ... IEEE International Conference on Sensor and Ad hoc Communications and Networks (SECON) Santa Clara, CA ZUNIGA, M AND KRISHNAMACHARI, B 2004b Realistic wireless link quality model and generator

Ngày tải lên: 28/04/2014, 13:41

33 253 0
The Impact of Spatial Correlationon Routing with Compressionin Wireless Sensor Networks

The Impact of Spatial Correlationon Routing with Compressionin Wireless Sensor Networks

... transmission cost data1 data2 data3 data4 data5 data6 2.4 9000 correlation parameter in log scale x 10 2.5 6000 2000 1000 2.6 data1 data2 data3 data4 data5 data6 11000 tranmission cost transmisssion ... to calculate approximately the total amount of uncorrelated data generated by a set of n nodes From Equation 2, it appears that on average, each new source contributes an amount of uncorrelated ... IEEE International Conference on Sensor and Ad hoc Communications and Networks (SECON) Santa Clara, CA ZUNIGA, M AND KRISHNAMACHARI, B 2004b Realistic wireless link quality model and generator

Ngày tải lên: 28/04/2014, 13:41

33 299 0
báo cáo hóa học:" Research Article Robust Distributed Noise Reduction in Hearing Aids with External Acoustic Sensor Nodes" ppt

báo cáo hóa học:" Research Article Robust Distributed Noise Reduction in Hearing Aids with External Acoustic Sensor Nodes" ppt

... hearing aids (node and 3) and the other has one hearing aid at the right ear (node 4) All hearing aids have three omnidirectional microphones with a spacing of cm Head shadow effects are not taken ... that all nodes can eventually make consistent selections A practical aspect that needs special attention is the adaptive estimation of the correlation matrices in the DANSEK algorithm In many ... hearing aid,” in Proceedings of IEEE Workshop on Applications of Signal Processing to Audio and Acoustics (WASPAA ’97), October 1997 V Hamacher, “Comparison of advanced monaural and binaural noise...

Ngày tải lên: 21/06/2014, 20:20

14 262 0
Cell culture microchip with built in sensor array for in situ measurement of cellular microenvironment

Cell culture microchip with built in sensor array for in situ measurement of cellular microenvironment

... case, a sugar binding protein Concanavalin A labeled with tetramethylrhodamine isothiocyanate (TRITC) is used as the receptor; dextran labeled with fluorescein isothiocyanate (FITC) is used as ... far from sufficient for an assay that normally requires milliliters of sample; and secondly if by any means you could manage to draw a certain amount of sample from the microchannels for a sample-out ... Dimethyl Siloxane FRET Fluorescence Resonance Energy Transfer FITC Fluorescein isothiocyanate TRITC Tetramethylrhodamine isothiocyanate LbL Layer-by-Layer Con A Concanavalin A PAH Poly(allylamine hydrochloride)...

Ngày tải lên: 03/10/2015, 11:36

149 373 0
w