a semantic role labeling system

... University {boxwe11,mehay,cbrew}@1ing.ohio-state.edu Abstract We describe a semantic role labeling system that makes primary use of CCG-based fea- tures. Most previously developed systems are CFG-based and make extensive use of a treepath ... simultaneous incremental parsing and semantic role labeling may lead to performance gains in both tasks. 1 Introduction Semantic Role Labeling (SRL) is the process of assign- ing semantic roles to strings ... approach (and lexicalist approaches in general) is the ability to en- code verb-specific argument mappings. An argument mapping is a link between the CCG category and the semantic roles that are...

Ngày tải lên: 17/03/2014, 01:20

Ngày tải lên: 31/03/2014, 00:20

... Krugler, Wayne Ward, James H. Martin, and Daniel Juraf- sky. 200 5a. Support vector learning for semantic argument classification. Machine Learning Journal. Sameer Pradhan, Wayne Ward, Kadri Hacioglu, James Martin, ... arguments, Arg0 is the Agent, Arg1 is Patient, etc. ArgM- may indicate adjunct arguments, such as Locative, Temporal. Many researchers (Gildea and Jurafsky, 2002; Pradhan et al., 200 5a) use feature-based ... fill a semantic role (argument) of the verb have to be recognized. Figure 1 shows an example of a semantic role labeling annotation in PropBank (Palmer et al., 2005). The PropBank defines 6 main arguments, Arg0...

Ngày tải lên: 20/02/2014, 12:20

... to classify each argument candidate as either an argument or not. Finally, a multi-class classifier is trained to label each argument recog- nized in the former stage with a specific semantic role ... natural number); the ad- juncts are annotated as such with the label AM followed by a secondary tag that represents the se- mantic classification of the adjunct. The assign- ment of semantic roles ... Ding and Chang, 2008)) First character, last character and word length of w v , first character+length, last character+word length, first character+position, last charac- ter+position, coarse frame,...

Ngày tải lên: 20/02/2014, 04:20

... Self-training for Semantic Role Labeling Rasoul Samad Zadeh Kaljahi FCSIT, University of Malaya 50406, Kuala Lumpur, Malaysia. rsk7945@perdana.um.edu.my Abstract Supervised semantic role ... amount of natural language text available at a low cost. Semi-supervised me- thods compensate the scarcity of labeled data by utilizing an additional and much larger amount of unlabeled data ... in- domain data. Among possible reasons are the low quality of the used data and the poor parses of the out-of-domain data. Another major factor that may affect the self- training behavior...

Ngày tải lên: 07/03/2014, 22:20

... shallow semantic parsing. In ACL04, Barcelona, Spain. Sameer Pradhan, Kadri Hacioglu, Valeri Krugler, Wayne Ward, James H. Martin, and Daniel Jurafsky. 2005. Support vector learning for semantic ... per- forms almost as good as the gold ILC. 5.4 Annotating PB with FN semantic roles To show that our approach can be suitable for semantic role free-text annotation, we have au- tomatically classified ... compatibility between a frame and a Levin class is that they share the same participant roles. As FN is anno- tated with frame-specific semantic roles, we man- ually mapped these roles into the VN...

Ngày tải lên: 08/03/2014, 02:21

... Resources and Evaluation (LREC-2002), Las Pal- mas, Canary Islands, Spain. Paul Kingsbury and Martha Palmer. 2002. From Treebank to PropBank. In Proceedings of LREC, Las Palmas, Canary Islands, Spain. Taku ... Advances in Large Margin Classifiers. MIT press, Cambridge, MA. Sameer Pradhan, Kadri Hacioglu, Wayne Ward, James Martin, and Dan Jurafsky. 2003. Semantic role parsing: Adding semantic structure ... Surdeanu, Sanda Harabagiu, John Williams, and Paul Aarseth. 2003. Us- ing predicate-argument structures for information extraction. In Proceedings of ACL, Sapporo, Japan. Nianwen Xue and Martha Palmer....

Ngày tải lên: 08/03/2014, 04:22

... vec- tor learning for semantic argument classification. Machine Learning Journal. Vasin Punyakanok, Dan Roth, Wen tau Yih, Dav Zimak, and Yuancheng Tu. 2004. Semantic role labeling via generalized inference ... NP Selected Pairs (Xue and Palmer, 2004) PREDICATE LEMMA & PATH PREDICATE LEMMA & HEAD WORD PREDICATE LEMMA & PHRASE TYPE VOICE & POSITION PREDICATE LEMMA & PP PARENT HEAD WORD Table ... Gildea, and Paul Kingsbury. 2003. The proposition bank: An annotated corpus of semantic roles. Computational Linguistics. Sameer Pradhan, Wayne Ward, Kadri Hacioglu, James Martin, and Dan Jurafsky....

Ngày tải lên: 08/03/2014, 04:22

... alia). Similarly, many researchers have explored tech- niques for robust, broad coverage semantic pars- ing in terms of semantic role labeling (Gildea & Jurafsky, 2002; Carreras & M ` arquez, ... essential features such as string matching, alias, pronoun and number. Similarly to Table 5, the semantic role of the anaphor ranks higher than the one of the antecedent. This re- 145 Semantic Role ... The tables show that SRL tends to improve system recall, rather than acting as a semantic filter’ improving pre- cision. Semantic roles therefore seem to trigger a R P F 1 A p A cn A pn baseline...

Ngày tải lên: 08/03/2014, 21:20

... semantics instantiate the same frame and are attested with the same roles. In our exam- ple, the frame Cause harm has three core semantic roles, Agent, Victim, and Body part and can be in- stantiated ... on Computational Natural Language Learning, pages 12–21, Prague, Czech Republic. Mihai Surdeanu, Sanda Harabagiu, John Williams, and Paul Aarseth. 2003. Using predicate-argument structures for information ... English FrameNet and rely on word or con- stituent alignments to automatically create an an- notated corpus in a new language. Pad ´ o and Lap- ata (2006) transfer semantic role annotations from English...

Ngày tải lên: 08/03/2014, 21:20

... Aous Mansouri, Martha Palmer, Olga Babko-Malaya, Wajdi Zaghouani, Ann Bies and Mohammed Maamouri, 2008. A pilot Arabic Prop- Bank. LREC ’08. Evgeniy Gabrilovich and Shaul Markovitch, 2005. Feature ... Lluis Villarejo, M. A. Mart ` ı and Mar- iona Taul ` e, 2007. SemEval–2007 Task 09: Multi- level Semantic Annotation of Catalan and Spanish. The 4th international workshop on Semantic Evalu- ations ... Extraction of Subcategorization from Corpora. Applied NLP 1997. Aljoscha Burchardt, Katrin Erk, Anette Frank, Andrea Kowalski, Sebastian Pad and Manfred Pinkal, 2006 The SALSA Corpus: a German Corpus...

Ngày tải lên: 17/03/2014, 01:20

... a i , 4) a i RAa j : a i is the referenced argument of a j , 5) a i ACa j : a j is the continuation argument of a i , 6) a i CAa j : a i is the continuation argument of a j , 7) a i = a j : a i and ... two arguments a i and a j , such as labeling a i  a j as ””, identification of thematic rank can be formulated as a classification problem. De- lemma, POS Tag, voice, and SCF of predicate categories, ... forward for classification. Experiments on CoNLL-2005 data show that this approach can get an good performance, achieving 96.42% ac- curacy on gold parsing data and 95.14% accuracy on Charniak automatic...

Ngày tải lên: 17/03/2014, 02:20

Ngày tải lên: 23/03/2014, 17:20

Ngày tải lên: 23/03/2014, 18:20

Ngày tải lên: 30/03/2014, 21:20

Ngày tải lên: 31/03/2014, 00:20

... to automatically create an annotated corpus in a new language. Although these data are typically quite noisy, they have been used to train automatic systems. For the particular case of transfer ... Martin, and Dan Jurafsky. 200 5a. Support vector learning for semantic argu- ment classification. Machine Learning, 60(1):11– 39. Sameer Pradhan, Wayne Ward, Kadri Hacioglu, James Martin, and Daniel ... 29(1):19–51. Sebastian Padó and Mirella Lapata. 2005. Cross- lingual projection of role -semantic information. In Proceedings of HLT/EMNLP 2005. Sameer Pradhan, Kadri Hacioglu, Valerie Krugler, Wayne Ward, James...

Ngày tải lên: 20/02/2014, 12:20

... 5¢-CCAGCTCTGCTTCAT TCCTCTCT-3¢ and 5¢-CGCAGGAATGGATAAACATA AGCA-3¢ for Cyp2c38; 5¢-ACTTCTCTGTGGCAAGCCC TGTTG-3¢ and 5¢-TCCACTAGCACAGATCACAGATC ATGG-3¢ for Cyp2b9; 5¢-TGCAGAACTTCCACTTCAA ATCCA-3¢ and 5¢-AATTTCCCCCTTCTCTGGCTACC-3¢ for ... 5¢-AATTTCCCCCTTCTCTGGCTACC-3¢ for Cyp 2a5 ; 5¢-TTGTTCTAAAAGTTGTGCCACGG GATG-3¢ and 5¢-AGAGATGATCCCATGAGAAACGG TGAA-3¢ for Cyp 3a4 4; 5¢-AGATCATCATTCCTTGGCA CTGG-3¢ and 5¢- ATTGCAGAAAGGAGGGAAGATGG -3¢ for Cyp 4a1 0; ... 5¢-CCAGTTGAGTGACGAGGAG ATGG-3¢ and 5¢-TCTGCATGCCCTCAAATGTTACC-3¢ for Akr1b8; 5¢-ACCACTCTCTGGATGTGATTGGA-3¢ and 5¢- TCAAGAACATTTTATTTCCCACATTTT-3¢ for Ugt2b5; 5¢-ATTGCCCATATGGTGGCCAAAGGAG-3¢ and...

Ngày tải lên: 16/03/2014, 14:20

Ngày tải lên: 17/03/2014, 22:20

Ngày tải lên: 23/03/2014, 18:20