a science for the record of past periods

Tài liệu Developing Culturally and Linguistically Competent Health Education Materials: A Guide for the State of New Jersey ppt

Tài liệu Developing Culturally and Linguistically Competent Health Education Materials: A Guide for the State of New Jersey ppt

... overview of a patient's asthma control with a quick glance Patients assume active role in their health care Implementation: The Asthma Task Force developed an Asthma Test, Asthma Management Plan, and ... within the health centers The Asthma Task Force developed medical record documents to facilitate superior asthma care (including an Asthma Test, Asthma Management Plan, and Asthma Action Plan), ... 1) In Navajo asthma patients, perceptions of asthma and beliefs about the activity of asthma medications influence when and how often asthma medicines are taken, as well as the use of health services...

Ngày tải lên: 14/02/2014, 13:20

24 525 0
Tài liệu Towards a framework for the study of the neural correlates of aesthetic preference pdf

Tài liệu Towards a framework for the study of the neural correlates of aesthetic preference pdf

... former case, there is the advantage of studying reactions to real art and the disadvantage that any two works of art differ from each other in several different respects, so that the actual factor ... preference have been captured by two of the reviewed studies: the representation of reward value and the awareness of the emotional state The cortical processing of the magnitude of the reward of the ... encompasses the region identified by Vartanian and Goel (2004), and has been related with the assessment of the relevance of motivational and emotional information and the regulation of emotional...

Ngày tải lên: 19/02/2014, 17:20

19 527 0
Báo cáo khoa học: "QARLA:A Framework for the Evaluation of Text Summarization Systems" pdf

Báo cáo khoa học: "QARLA:A Framework for the Evaluation of Text Summarization Systems" pdf

... framework, QARLA, that addresses such issues Given a set of manual summaries and another set of baseline summaries per task, together with a set of similarity metrics, QARLA provides quantitative measures ... estimates the quality of an automatic summary a ∈ A, given a set of models M and a similarity metric x An obvious first attempt would be to compute the average similarity of a to all model summaries ... compare the summary with the models in M With Q, we can compare the quality of automatic summaries • A measure KM ,A (X) ∈ [0, 1] that estimates the suitability of a set of similarity metrics X for...

Ngày tải lên: 17/03/2014, 05:20

10 518 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGCTGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTCAGCTCGTGTTGACGCAGCCGCC ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCCAGATGACCCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Báo cáo khoa học: "A Language for the Statement of Binary Relations over Feature Structures" ppt

Báo cáo khoa học: "A Language for the Statement of Binary Relations over Feature Structures" ppt

... often the case that a grammar assigns just one of a range of logically equivalent representations to a sentence; designers of grammars for use in analysis generally take care to ensure that the ... translation application Similarly, the transfer rules of Zajac (1990) express a relation between subparts of a single complex structure Such an approach does not appear suitable for the appl/cation ... An alternative is to define equivalence classes of representations, and reduce all members of a class to the single canonical form which the grammar can map into a senfence Exactly how the classes...

Ngày tải lên: 01/04/2014, 00:20

6 348 0
báo cáo hóa học:" Botulinum toxin type A injections for the management of muscle tightness following total hip arthroplasty: a case series" pptx

báo cáo hóa học:" Botulinum toxin type A injections for the management of muscle tightness following total hip arthroplasty: a case series" pptx

... manuscript AB, MGZ, MSM, RED, MAM ensured the accuracy of the data and analysis All authors have read and approved the final manuscript Additional material Additional file Summary of patients treated ... to assess the clinical outcome Patients were also evaluated using the Harris hip score rating system [22] Statistical Analysis Data was subjected to averaging and analysis using Sigma Stat software ... holding the joint at the end of their range for 30 seconds, followed by manual application of 15 to 20 oscillations at the end range of motion All of the manual therapy was performed with opposite...

Ngày tải lên: 20/06/2014, 04:20

7 469 0
Báo cáo hóa học: " Research Article A Framework for the Assessment of Temporal Artifacts in Medium Frame-Rate Binary Video Halftones" pot

Báo cáo hóa học: " Research Article A Framework for the Assessment of Temporal Artifacts in Medium Frame-Rate Binary Video Halftones" pot

... temporal artifacts in the halftone videos Therefore, perceptual quantitative measures for evaluating these artifacts are desirable Quantitative assessment of temporal artifacts can facilitate comparison ... dirty-window-effect For the perceptual evaluation of each artifact, a particular instantiation of the generalized framework, was presented and the associated results were EURASIP Journal on Image and Video ... This instantiation of the flicker assessment framework is depicted in Figure In Figure 9, K, Q, and R each have a value of L, and S have each a value of P has a value of −1 The “Artifact Map” is...

Ngày tải lên: 21/06/2014, 08:20

11 520 0
Creating an Inclusive Environment: A Handbook for the Inclusion of People with Disabilities in National and Community Service Programs ppt

Creating an Inclusive Environment: A Handbook for the Inclusion of People with Disabilities in National and Community Service Programs ppt

... tử ba minh h a ví dụ sau Sử dụng toán tử bao using System; class Tester { public static int Main() { int value1; int value2; int maxValue; value1 = 10; value2 = 20; maxValue = value1 > value2 ... foreach Câu lệnh lặp foreach với người học ngôn ngữ C, từ kh a sử dụng ngôn ngữ Visual Basic Câu lệnh foreach cho phép lặp qua tất mục mảng hay tập hợp Cú pháp sử dụng lệnh lặp foreach sau: foreach ... b Công thức khai báo mảng Datatype [] variableName = new Datatype [number of elements]; Trong đó: number of elements: số phần tử mảng Datatype: kiểu liệu mà mảng lưu trữ variableName: tên mảng...

Ngày tải lên: 28/06/2014, 23:20

103 485 0
Báo cáo khoa học: "Comparison of RBE values of high- LET a-particles for the induction of DNA-DSBs, chromosome aberrations and cell reproductive death" potx

Báo cáo khoa học: "Comparison of RBE values of high- LET a-particles for the induction of DNA-DSBs, chromosome aberrations and cell reproductive death" potx

... only the values of a are considered for evaluation and discussion of RBE values These values are summarized in table The values for the quadratic parameters for cell survival, chromosomal fragments ... the conclusion that only a small fraction of the DSB (about 1% of DSB induced by g-rays and about 10% by a- particles) are causing cell death On the other hand, the values of a for formation of ... Sugahara S, Yasuda S, Yamamoto N, Imai R, Hasegawa A, Imada H, Kiyohara H, Jingu K, Shinoto M, Tsujii H: Carbon Ion Radiotherapy: Clinical Experiences at National Institute of Radiological Science...

Ngày tải lên: 09/08/2014, 09:20

8 330 0
Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf

Báo cáo y học: " Development and evaluation of a tool for the assessment of footwear characteristics" pdf

... distally along the shoe), medial (greater medial than lateral wear at the heel and forefoot), which may indicate excessive pronation, or lateral (greater lateral than medial wear at the heel and forefoot), ... range of each measure across included footwear was also reported Intra-rater and inter-rater reliability for all categorical data was evaluated using percentage agreement, and kappa (κ) statistics ... and calculating the difference The difference was then compared to the footwear owner's thumb width (measured by ruler at the base of the nail) and categorised in the same way as the palpation...

Ngày tải lên: 10/08/2014, 21:23

12 379 0
báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx

báo cáo khoa học: " Whole-Organ analysis of calcium behaviour in the developing pistil of olive (Olea europaea L.) as a tool for the determination of key events in sexual plant " ppsx

... precipitates The spectrum of the material reveals peaks for Ca and Sb The strong decrease of the Ca2+ pool in the pistil at the last stages of pistil development coincides with the degradation of the ... maximal values just after anther dehiscence (stage 4) At the latest analyzed stage (stage 5) a significant decrease of Ca2+ levels was observed in the upper parts of the pistil (stigma and style) ... exudates (arrowheads) (E) In the stigma of a flower without petals and anthers (stage 5), Ca/Sb deposits are less abundant and present mainly on the surface of degenerating papillae cells and...

Ngày tải lên: 11/08/2014, 11:21

12 529 0
báo cáo khoa học: " Synthetic lethality: a framework for the development of wiser cancer therapeutics" docx

báo cáo khoa học: " Synthetic lethality: a framework for the development of wiser cancer therapeutics" docx

... human salivary gland cancer cells Oral Oncol 2006, 42:593598 44 Hayashi M, Sakata M, Takeda T, Tahara M, Yamamoto T, Okamoto Y, Minekawa R, Isobe A, Ohmichi M, Tasaka K, Murata Y: Up-regulation ... normal tissues and for tackling ‘undruggable’ targets Technological advances, coupled with the availability of large siRNA and shRNA libraries, now make unbiased synthetic lethal screens in mammalian ... robust rather than peculiar to a particular line [41] Hahn, Gilliland and coworkers [53,54] realized that if data for shRNA-mediated changes in cellular fitness were available for enough cancer...

Ngày tải lên: 11/08/2014, 12:20

6 485 0
Báo cáo y học: " RNA silencing and HIV: A hypothesis for the etiology of the severe combined immunodeficiency induced by the virus" pot

Báo cáo y học: " RNA silencing and HIV: A hypothesis for the etiology of the severe combined immunodeficiency induced by the virus" pot

... of the (many) targets of the HIVaINR antisense RNA miRNAs (HAAmiRNAs) is the human interleukin-2 receptor gamma chain, also known as the gamma common chain because it is a component of separate ... components and miRNAs [73-75] Mammalian FMRP interacts with miRNAs and Dicer and the mammalian orthologues of Argonaute (AGO) [73,75] Whether HAAmiRNA targeting human mRNA for FMRP results in translational ... gamma chain (common gamma chain) (γC)- a proposed human mRNA target of the HIVaINR antisense RNA site (HAAmiRNA 1, 1*) The HIVaINR antisense RNA stem-loop precursor (HAAmiRNA 1,1*) also contains...

Ngày tải lên: 13/08/2014, 05:21

13 301 0
Báo cáo y học: "A health economic model for evaluating a vaccine for the prevention of herpes zoster and post-herpetic neuralgia in the UK" ppsx

Báo cáo y học: "A health economic model for evaluating a vaccine for the prevention of herpes zoster and post-herpetic neuralgia in the UK" ppsx

... detail of 5-year age bands, the analysis of a single age group resulted in nearly identical ICERs as that of the 5-year age group it falls within For example, if a vaccination strategy was applied ... underestimated The underestimation of costs does have the advantage that it does not favour the vaccine arm and therefore represents a conservative approach A sensitivity analysis which varied all health ... i.e an 8% increase and a 12% decrease respectively In addition, the base case assumes that the efficacy of the vaccine is constant over the lifetime of the population, therefore an assumption of...

Ngày tải lên: 13/08/2014, 11:22

14 317 0
Báo cáo y học: " How to select a chiropractor for the management of athletic condition" potx

Báo cáo y học: " How to select a chiropractor for the management of athletic condition" potx

... second hand information although it was apparent that the registrars understood that there were "good and bad chiropractors" Chiropractors and manual therapists are an integral part of the treatment ... is often a function of time, treatment should also be multimodal in nature The manual therapy and chiropractic literature and education suggests the multimodal approach as the logical way to patient ... implement a management strategy that addresses pain and acute inflammation in conventional ways, along with rehabilitation or exercise prescription [1], all of which are fundamental for the management...

Ngày tải lên: 13/08/2014, 14:20

4 299 0
Báo cáo y học: " A method for the generation of standardized qualitative dynamical systems of regulatory networks" doc

Báo cáo y học: " A method for the generation of standardized qualitative dynamical systems of regulatory networks" doc

... paragraph, the equations have the same qualitative shape for any value assigned to the parameters Hence, for the sake of simplicity, it is possible to assign the same values to most of the parameters, ... that the activation of a node has the form of a sigmoid, bounded in the interval [0,1] regardless of the values of h xa xa Figure 10 Activation of a node as a function of one positive input Activation ... has a total of 58 parameters, all of which were set to the default value of 1, and one parameter (the gain of the sigmoids) with a default value of 10 This set of default values sufficed to capture...

Ngày tải lên: 13/08/2014, 23:20

18 288 0
Báo cáo y học: "The Sequence Ontology: a tool for the unification of genome annotations" potx

Báo cáo y học: "The Sequence Ontology: a tool for the unification of genome annotations" potx

... searching and querying capa- interactions SO also greatly facilitates the automatic validation of annotation data, as the relationships implied by an annotation can be compared to the allowable ... separable England is a part _of Britain feature_part _of activity Functional/heteromerous/not separable Inhaling is a part _of breathing Translation is part _of protein synthesis A sheep is a part _of ... heteromerous); and invariance, whether the part can be separated from the whole These six relations and their associated part _of subclasses are detailed in Table Winston et al [25] argue that there is transitivity...

Ngày tải lên: 14/08/2014, 14:21

12 299 0
w