... solving the steady-state Navier-Stokes equations, i.e the continuity equation, the mass conservation equation for each phase yields the volume fraction (r ) and along with the momentum equations the ... membrane hydration and avoidance of water flooding in the cathode catalyst layer and/or gas diffusion layer [2] Water management is related with air supply to the cathode and is one of the crucial ... near the cathode side area The maximum stress appears in the cathode side surface of the membrane, implying that major heat generation takes place near this region It can be seen also that the...
... predominantly classical ones We can find the explanation for this behaviour in the fact that these indicators are much easier to measure In addition, conventional methods have the advantage of being ... evaluation settings Their major drawback of evaluation is that they focus onthe estimation of cash flows and accounting criteria (Kim, Suh and Hwang, 2003) Nevertheless, traditional performance ... 2000; Kaplan and Norton, 1992) They not link the non-financial metrics to financial numbers (e.g Kaplan and Norton, 1992) Traditionally financial and non-financial measures have been seen as opposed,...
... interco-operation, social transformation, universal character, education The mission and corporate values summarize the corporation and the culture of all the firms belonging to it: customer satisfaction, ... external relations, education and training, working teams and committees and the assembly system for decisions All of these are based on participation in the process Although the new information ... knowledge and information: that is, an interaction between actions and behaviors The action of CASE STUDY creation does not consist of the processing of information or data, since the obtaining of tacit...
... Pakistan and Bangladesh have lower education and occupational qualifications than whites, on average, those from India, Africa and China have higher average qualifications (Modood 2003) Although ... and health incorporation onthe patterns observed among the total population—in social institutions such as the educational and health care systems, and on markers of health and social inequality ... associated with health Onthe one hand, positive health selectivity among natives and a lack of systematic health-related attrition among the foreign-born suggests that the immigrant health advantage...
... Americans went on within a century to succeed the English as the world’s pre-eminent national economy Larry Neal, The Rise of Financial Capitalism: International Capital Markets in the Age of Reason ... question is that the agencies gather and analyze all sorts of pertinent financial and other information, and the n use it to provide a rating of the intrinsic value or quality of a security as a convenient ... of data allowing one to compare historical bond market developments across countries His data appear to indicate that as early as 1850 the U.S corporate bond market was as large or larger than...
... that it has all been done on purpose, and that none of them are accidents or surgical diseases And they seem all to take it as a matter of course; the bad ones who are conscious don't speak, and ... for the troops at the theatre at The Padres and a Union Jack and the Allies' Flags; and a piano onthe stage; officers and sisters in the stalls; and the rest packed tight with men: they were very ... that only the Reichstag and the Kaiser wanted the War; that Russia began it, so Deutschland mussen; that Deutschland couldn't win against Russia, France, England, Belgium, and Japan; and that there...
... conditional clauses4: valid and invalid A valid conditional clause refers to a real occurrence; an invalid conditional clause relates to a hypothetical situation that has not, will never, or can never ... the criminal norm contains only valid conditional clauses A valid conditional clause that is part of the criminal norm contains the components necessary to impose criminal liability onthe offender ... than three years The criminal norm contains two parts: a valid conditional clause and a criminal sanction Both parts are required to identify the criminal norm (Another reason why the Biblical...
... thus one candidate for an acceptable translation Because the prepositional phrase is a modifier of the main process (indicated by the role feature and the fact that the main process and the modifier ... consider all the grammatical constructs and lexical items of English that Nigel has available for realizing this concept In particular,one of the English realizationsmay be the English preposition since, ... semantic organisation that the grammar's semantics requires These categories, and the relationships among them, constitute the upper model The upper model serves to organize the propositional content...
... GTCCCCAGCAGCAGCAGTA GAGGTGAGCCGATGGAGATTTA CCTCTCAGGCGCTCAGCTTC TCTCCGGCGAGATGTCCGA GCTCCAGTGAATCCAGGTTG TCTCCGGCGAGATGTCCGA GGCAGCGATCACCAGTAAAC GAAGGGCTCATGACCACAGTCCAT TCATTGTCGTACCAGGAAATGAGCTT ... NRG -a_ rev NRG-5¢_for NRG-Beta_rev GAPDH_for GAPDH_rev TGAAAGACCTTTCAAACCCCTC GTTTTGCAGTAGGCCACCAC GCCAGGGAAGTCAGAACTTC GTTTTGCAGTAGGCCACCAC CCACAGAAGGAGCAAATACTTC GTTTTGCAGTAGGCCACCAC AGGAGGAGGAGTGGTGCTG ... (0.2 lm each) Amplificates were analyzed on 1% agarose gels and GAPDH amplification served as a control for the RT-PCR reaction and PCR conditions Primer sequences and the amplificate length are provided...
... artifact As regards the nature of the signal, the lack of a visible negative absorptionshaped peak at higher magnetic fields appears to be, at first glance, indicative of an axial signal However, a closer ... signal strongly varied from preparation to preparation A decrease in specific activity was always accompanied by an increase in signal intensity, suggesting that the g ¼ 2.01 signal is an artifact ... signal results from a Rhodobacter-specific contamination or from an artifact caused by the preparation conditions applied In fact, when we isolated and prepared the protein components of the Mo...
... a daily paper than average, but still more than a quarter (29%) of U.S persons 18–20 say they read a daily newspaper on an average day About a third, 34%, say they read a paper on an average ... applications more than average, though considerably less than Brazilian teens Australia Mobile: Always Connected Myth: The only way to reach teens over their phone is texting Figure 12: Average ... who recall TV ads are 44% more likely to say they liked the ad • Teens play video games, but are as excited about play-along music games and car-racing games as they are about violent ones: Just...
... Gammopathies 93 Lucie Rihova, Karthick Raja Muthu Raja, Luiz Arthur Calheiros Leite, Pavla Vsianska and Roman Hajek Chapter Monoclonal Gammopathy of Undetermined Significance 111 Magdalena Patricia ... monoclonal diseases, the cell starts to synthesize Ig following the variable domain rearrangement Onthe coding DNA strand, the gene segments for the formation of the variable and the constant ... Biology and the Impact of Drugs Marina Ferrarini, Giovanna Mazzoleni, Nathalie Steimberg, Daniela Belloni and Elisabetta Ferrero Additional information is available at the end of the chapter http://dx.doi.org/10.5772/54312...
... response to the changes, and about the process for municipal decisionmaking; discover what provincial and local actions are taking place in response to the changes; have a chance to say what ... to municipalities means that municipalities will either have to dramatically increase their own financial contribution to benefits or reduce the benefits that are provided The provincial government ... Ontario Works (OW) and the Ontario Disability Support Program (ODSP): $20 million as a result of the new overall cap on discretionary health and nonhealth related benefits, to take effect July...
... B.L., Ali, F & Samanen, J (1989) Demonstration of Ac–Arg–Gly–Asp–Ser–NH2 as an antiaggregatory agent in the dog by intracoronary administration Thromb Haemost 61, 183–188 Samanen, J., Ali, F., ... maximal aggregation, achieved within after addition of the agonist, was determined and expressed as a percentage of 100% light transmission calibrated for each specimen (maximal percentage of aggregation) ... platelet aggregation) Typical aggregation curves illustrating the inhibitory effect of these peptides on ADP-induced platelet aggregation, as well as typical sigmoidal curves for the estimation of the...
... This location would be advantageous to facilitate the amphipathic interaction between the peptide and the membrane surface, as the tryptophan side chain is amphiphilic in nature The tryptophan side ... are deeply related to their conformational properties and helical contents in various environments In addition, it became clear that the D16W substitution of both the native and the C-terminally ... Scans were taken with a 5-nm excitation and emission bandwidth, a 0.5-s response time, and a scan speed of 40 nmÆs)1 All samples contained lM peptide or the same concentration of NATA for control...
... tabulate the costs of programs being evaluated and a conversion of the data into monetary value The intangible benefits are taken out of the equation and treated as an independent variable The ... (2000) advocated the usage of Norton and Kaplan’s (1996) Balanced Scorecard as a means to track progress with a KM program and posed some advantages and disadvantages of doing so The advantages ... Market Value Added (MVA) method; Economic Value Added (EVA); and, Citation-weighted Patents Each had their own merit and there appeared to be a central theme that ran through them all There has...