... internalization, we investigated the role of plasma membranes (PM) in the transformation of MSSAE into a dimeric protein 125I-labelled MSSAE was incubated with isolated membranes from SVT2 broblasts ... MSSG (lane 3), MSSAE from a lysate performed in the presence of mM iodoacetamide (lane 4), BS-RNase from a lysate performed in the presence of mM iodoacetamide (lane 5), MSSAE as in lane after ... into the parent dimeric protein, which is internalized as a native-like dimeric RNase They also indicate for the rst time that when BS-RNase is internalized by malignant cells, it maintains its...
Ngày tải lên: 20/02/2014, 11:20
... The Institute for International Law of the K.U.Leuven groups the teaching and research in public international law and the law of international organisations at the Faculty of Law of the ... that an international criminal court would be an adequate and even indispensable tool in an effective combat against powerful international drug cartels.1 Pursuant to the initiative of Trinidad ... disqualification of such a judge Previous involvement, in any capacity, in the case before the Court or in a related criminal case at the national level, involving the person being investigated...
Ngày tải lên: 10/07/2014, 13:21
Báo cáo y học: "A case-control study of rheumatoid arthritis identifies an associated single nucleotide polymorphism in the NCF4 gene, supporting a role for the NADPH-oxidase complex in autoimmunity" doc
... draft the manuscript Additional files 12 13 The following Additional files are available online: Additional file An Word file containing a table that shows a table of all SNPs evaluated for association ... all information regarding genetic factors, antibodies and matching variables was available This same sample set was used for the frequency analysis of rs729749 We used the SAS software for Windows ... 71% and 72%, respectively, are female; the mean age was 51 ± 13 years in cases and 54 ± 12 in controls Information about RF and anti-CCP antibody status was available for 1,315 of the patient samples;...
Ngày tải lên: 09/08/2014, 10:21
Báo cáo y học: "A role for the histone deacetylase HDAC4 in the life-cycle of HIV-1-based vectors" ppsx
... quantitate the viral amplicon, a TaqMan dual 5′-6-carboxyfluorescein-and 3′-6-carboxytetramethylrhodamimine-labeled probe was used: 5′-(FAM)-CAGTGGCGCCCGAACAGGGA(TAMRA)-3′ (Integrated DNA Technologies) ... immunoprecipitated with antibodies against HDAC2 and HDAC6, as indicated Terminology as above, * indicates samples from A (C) Effect of an integrase inhibitor on the association of HDAC4 with vector DNA ... protein We show that the formation of these foci is dependent on active retroviral integrase, and HDAC4, but not HDAC2 and HDAC6, associates with viral DNA Taken together, these data indicate that...
Ngày tải lên: 12/08/2014, 01:21
Báo cáo khoa học:" A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" docx
... of the STAT1 gene in mice revealed a role for STAT1 in the JAK-STAT signaling pathway [40] The JAK-STAT signaling pathway is involved in mediating biologic responses induced by many cytokines ... bp; and 4) gB: forward primer, 5'AACGCGACGCACATCAAG-3', reverse primer, 5'-CTGGTACGCGATCAGAAAGC-3'; and probe, 5'-FAMCAGCCGCAGTACTACC-3' – Amplicon length = 72 bp As an internal control, a set ... replication was determined as in Fig Each point represents the mean ± SEM (n = 16) Panel B DNA was isolated and the amount of viral genomic DNA was determined by Taq-Man PCR as described in Materials...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: " A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" pps
... of the STAT1 gene in mice revealed a role for STAT1 in the JAK-STAT signaling pathway [40] The JAK-STAT signaling pathway is involved in mediating biologic responses induced by many cytokines ... bp; and 4) gB: forward primer, 5'AACGCGACGCACATCAAG-3', reverse primer, 5'-CTGGTACGCGATCAGAAAGC-3'; and probe, 5'-FAMCAGCCGCAGTACTACC-3' – Amplicon length = 72 bp As an internal control, a set ... replication was determined as in Fig Each point represents the mean ± SEM (n = 16) Panel B DNA was isolated and the amount of viral genomic DNA was determined by Taq-Man PCR as described in Materials...
Ngày tải lên: 12/08/2014, 04:21
a role for the endosomal snare complex and tethers in autophagy
... in maintaining cell viability Finally, I also investigated a role for endosomal trafficking and autophagy in C.elegans post-embryonic development and identified a role for these pathways in the ... evolutionary conserved and adaptive catabolic process that plays a central role in maintaining intracellular homeostasis and thereby cellular health The term ‘autophagy’ directly translates to ... under autophagy inducing conditions The PAS therefore defines the focal point for the assembly of Atg proteins which are recruited in a hierarchical fashion during the early stages of autophagy The...
Ngày tải lên: 22/12/2014, 21:44
A role for chondroitin sulfate proteoglycan in regulating the survival and growth of neural stem cells
... to the basal side during G1 phase, being at the basal side during S phase, migrating back to the apical side during G2 phase, and mitosis occurring at the apical surface (b) In radial glial cells, ... start of each hair cycle In addition, they are activated during tissue damage and participate in wound healing (Blanpain and Fuchs, 2006) In the skin epidermis between hair follicles the basal ... occurs Red areas indicate the germinal zones in the adult mammalian brain: the subgranular zone (SGZ) of the dentate gyrus in the hippocampus and the subventricular zone (SVZ) of the lateral ventricles...
Ngày tải lên: 12/09/2015, 21:26
ORCHESTRATING FEAR RESPONSES IN LARVAL ZEBRAFISH a ROLE FOR THE HABENULA
... medial and lateral habenula from the median raphe, and dopaminergic innervations to the lateral habenula from the ventral tegmental area of Tsai (Sutherland, 1982) The monoaminergic signals may ... termed the medial and lateral habenula in mammals The majority of afferent fibers travel to the habenula in the stria medullaris and efferent fibers travel away from the habenula in the fasciculus ... systems in the brain release neurotransmitters such as norepinephrine, acetylcholine, serotonin, and dopamine throughout the brain These neurotransmitters increase arousal and vigilance in the animal...
Ngày tải lên: 16/10/2015, 12:00
báo cáo khoa học: " A role for neurotransmission and neurodevelopment in attention‑deficit/hyperactivity disorder" ppsx
... genes, an association with BAIAP2 was detected, by both the singleand multiple-marker analyses, in the adult ADHD Spanish sample In the replication study, the association with this locus was also ... concluded that genetic factors possibly influencing abnormal cerebral lateralization may be involved in ADHD etiology, with BAIAP2 acting specifically in cases of persistent ADHD BAIAP2 is located at ... 17q25 and encodes the 53 kDa insulin receptor tyrosine kinase substrate protein (IRSp53), a molecule that participates in the signal transduction path ways of insulin and insulin-like growth factors...
Ngày tải lên: 11/08/2014, 12:20
Báo cáo y học: "A role for age-related changes in TGFβ signaling in aberrant chondrocyte differentiation and osteoarthritis" ppt
... I, Iida A, Sudo A, Miyamoto Y, Fukuda A, Mabuchi A, Kotani A, Kawakami A, Yamamoto S, Uchida A, Nakamura K, Notoya K, Nakamura Y, Ikegawa S: An aspartic acid repeat polymorphism in asporin inhibits ... months The ALK1/ ALK5 ratio was on the medial tibia at an age of months and was 18 in 1-year-old animals The lateral tibia showed a ratio increase from to in the same period Clearly an increased ALK1/ALK5 ... and alkaline phosphatase These observations clearly demonstrate that terminal differentiation of articular chondrocytes is associated with dominant signaling via the Smad1/5/8 pathway [69] The latter...
Ngày tải lên: 12/08/2014, 11:22
Báo cáo y học: "A role for MCP-1/CCR2 in interstitial lung disease in children" pps
... Ichiyasu H, Yamamoto T, Hiraga Y, Ando M: Measurement of serum monocyte chemoattractant protein1 and its clinical application for estimating the activity of granuloma formation in sarcoidosis Sarcoidosis ... participated in the study design TN performed bronchoalveolar lavage and patient characterization GZ and CP participated in the experimental analyses DR and DJS participated in the study design and reviewed ... capacity (FVC) and total lung capacity (TLC)) according to the ATS criteria[34] The diagnosis of the specific form of ILD was established by patient history, physical examination, HRCT, BAL and/...
Ngày tải lên: 12/08/2014, 18:22
báo cáo hóa học: " A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type 1 by glial cells" pot
... Rintahaka J, Søby S, Horan KA, Poltajainen A, Østergaard L, Paludan SR, Matikainen S: Early innate recognition of herpes simplex virus in human primary macrophages is mediated via the MDA5/MAVSdependent ... HSV-1 and elicit inflammatory CNS damage Replicating DNA viruses generate genomic DNA that serves as a ligand for DAI DAI then associates with IPS-1 and STING, subsequently activating NF-kB via the ... Cambridge, MA), STING (Abcam, Cambridge, MA) or a mouse monoclonal antibody against gG1 (Abnova, Taipei, Taiwan) for 24 hours at 4°C, blots were washed and incubated in the presence of an horseradish...
Ngày tải lên: 19/06/2014, 22:20
Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc
... hexamer primers (Pharmacia, Woerden, The Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense (CGCACACAGTAGTCCCCGG) ... stress-activated protein kinases, also called cJun NH2-terminal kinases (JNKs); and the p38 MAPKs [13] The JNK pathway is of interest because of its capacity to phosphorylate the amino acids serine-63 ... signal transduction pathway is involved in the TNF-α-mediated increase in Cyp7b activity in human FLS Signaling pathways that mediate the effects of TNF-α include mitogen-activated protein kinases...
Ngày tải lên: 09/08/2014, 07:20
Báo cáo y học: " Angiotensin-converting enzyme 2 autoantibodies: further evidence for a role of the renin– angiotensin system in inflammation" potx
... ACE inhibition ameliorated the autoimmune in ammation [7] The present findings by Takahashi and colleagues reveal increased expression of circulating ACE2 in patients with vasculopathy utilizing ... mechanism to alter the balance of the renin–angiotensin system to favor the ACE2– Ang-(1–7)–AT7 receptor axis and promote the antifibrotic and anti -in ammatory actions of the heptapeptide, as well ... aldosterone antagonists which may increase basal ACE2 expression potentially contributing to the protective mechanisms of these therapies There is increasing evidence for the interplay of the renin–angiotensin...
Ngày tải lên: 12/08/2014, 14:22
Báo cáo y học: "A role for adrenomedullin in the pathogenesis of alveolar edema" pdf
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: "Genomic neighborhoods for Arabidopsis retrotransposons: a role for targeted integration in the distribution of the Metaviridae" docx
... RetroMap-generated datafile was used as the data source for statistical testing The data file contains chromosomal element coordinates, LTR identity, age and lineage information for all A thaliana ... element abundance in A thaliana Wright et al [33] examined recombination rate relative to element abundance in detail and found that the abundance of most A thaliana TE families actually had a small ... that of the Pseudoviridae than to the mean lengths of the Athila and Tat lineages The Pseudoviridae are also more uniformly sized than the Metaviridae A second factor contributing to the abundance...
Ngày tải lên: 14/08/2014, 14:21
Báo cáo y học: "A genome wide analysis of the response to uncapped telomeres in budding yeast reveals a novel role for the NAD+ biosynthetic gene BNA2 in chromosome end protection" doc
... measurements Table Primers for Q RT-PCR Primer Alias Sequence 1082 ACT1F GCCTTCTACGTTTCCATCCA 1083 ACT1R GGCCAAATCGATTCTCAAAA 1367 PAC2F AATAACGAATTGAGCTATGACACCAA 1368 PAC2R AGCTTACTCATATCGATTTCATACGACTT ... GTAACCAGTACGAAAAAAGATA CATTT 1165 MSC1F TCTTCGGATCACCCAGTTTC 1278 NPT1 5' 1166 MSC1R G AAGCCTTAGCGTCGTCAAC CATTGTGATTTTATTCAATGTTT CTTT 1084 CTT1F AAAGAGTTCCGGAGCGTGTA 1279 NPT1 3' CAGGGTGTGGAAGAACAGGT ... are uncapped in the absence of BNA2, intracellular NAD+ levels may be maintained by the NAD+ salvage pathway Further experiments are required to determine the mechanism by which BNA2 affects...
Ngày tải lên: 14/08/2014, 21:20
phosphatidylserine exposure in red blood cells: a suggestion for the active role of red blood cells in blood clot formation
... normal conditions, they exist in zymogens In initial stage, the caspase or caspase 10 is activated and later they activate other caspases in a cascade This cascade eventually leads to the activation ... effect was paralleled by RBC shrinkage, which was apparent on the basis of the decrease in forward scatter of FACS analysis [110] Caspases are a family of cysteine proteinases involved in the apoptotic ... an integral membrane domain (F0) acting as H+ channel and a peripheral domain (F1), which is of importance for both ATP-synthase and ATPase activity This type of ATPases plays a central role in...
Ngày tải lên: 15/11/2015, 12:54
A role for selfgravity at multiple length scales in the process of star formation
... such a comparison (see Supplementary Information) with a plot showing the fraction of ‘self-gravitating’ (aobs , 2) material as a function of spatial scale for both our L1448 data and for a synthetic ... illustrates the smallest scale selfgravitating structures in the region corresponding to the leaves of the dendrogram; pink shows the smallest surfaces that contain distinct selfgravitating leaves ... to quantify these uncertainties more finely Comparative measurements (for example Fig 4) are far more certain as these biases should affect all data sets similarly Thus, the apparent disagreement...
Ngày tải lên: 16/06/2016, 01:09