... CCCCGAGGGCTGTGCTA TGAACTTCAACTGGAACAGGGTATC Aggrecan 0.992 2.15 TCTACCCCAACCAAACCGG AGGCATGGTGCTTTGACAGTG Collagen X 0.992 1.97 CACACTCTGTCCTCGTGCTTTG GGAATCCCTGTAAGACACACCAA Mice were injected intraperitoneally ... Therefore, the safranin O staining intensity was scored in patellar and tibial cartilage with a computerized imaging system There was a significant (30%) increase in safranin O staining intensity ... stimulation also leads to increased VDIPEN staining (k) and NITEGE staining (q,p) Arrows point to intense staining around chondrocytes FastG, fast green; SafO, safranin O Co-incubation of several...
Ngày tải lên: 09/08/2014, 10:21
... seen after 26 days of culture mMCP-6 storage showed similar kinetics as for mMCP-5 In contrast, CPA protein was detected as early as after days of culture, and a maximal plateau of storage was already ... Although b-hexosaminidase activity was already detected at day 0, the intracellular content of this enzyme increased markedly after days of culture, and reached a plateau from about day 12 (Fig 2B) ... metachromatically staining granules seen in mature MCs have been poorly investigated In a recent study, we generated a mouse strain in which the SG gene was targeted [10] We found that, in the absence...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo y học: "A model of inflammatory arthritis highlights a role for oncostatin M in pro-inflammatory cytokine-induced bone destruction via RANK/RANK" pps
... causes profound bone damage with osteoclast formation and activation, and increased expression of RANK/ RANKL in inflammatory cells, in inflamed synovium, in articular cartilage and at the invading ... differentiation and activation induced by osteoprotegerin ligand Proc Natl Acad Sci USA 1999, 96:3540-3545 Kobayashi K, Takahashi N, Jimi E, Udagawa N, Takami M, Kotake S, Nakagawa N, Kinosaki M, Yamaguchi ... corresponding to amino acids 317–616 mapping at the carboxy terminus of RANK of human origin [H-300]) or against RANKL (rabbit polyclonal antibody raised against the epitope corresponding to amino acids...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "A role for prophylactic antibiotics in necrotizing pancreatitis" doc
... essential in pancreatic infection, just as in any other (intra-abdominal) infection Therefore, a low threshold for an aggressive diagnostic approach to ‘search for and destroy’ infection is still warranted ... a treatment modality that has no relevant side effects and that can be initiated in a timely fashion, the role of antibiotics in patients with established pancreatitis remains in the treatment ... disease Ann Surg 2007, 246:689 10 Bradley EL 3rd: A clinically based classification system for acute pancreatitis Summary of the International Symposium on Acute Pancreatitis, Atlanta, Ga, September...
Ngày tải lên: 13/08/2014, 11:23
Báo cáo y học: "Genomic neighborhoods for Arabidopsis retrotransposons: a role for targeted integration in the distribution of the Metaviridae" docx
... element abundance in A thaliana Wright et al [33] examined recombination rate relative to element abundance in detail and found that the abundance of most A thaliana TE families actually had a small ... RetroMap-generated datafile was used as the data source for statistical testing The data file contains chromosomal element coordinates, LTR identity, age and lineage information for all A thaliana ... coordinates Excel The here and tospreadsheet Click for application insertion identified; the data used retrotransposon analyses of eachJavaalldata fileestimate retrotransposon and RetroMap for A...
Ngày tải lên: 14/08/2014, 14:21
Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc
... transduction pathway is involved in the TNF-α-mediated increase in Cyp7b activity in human FLS Signaling pathways that mediate the effects of TNF-α include mitogen-activated protein kinases (MAPKs) and ... Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense (CGCACACAGTAGTCCCCGG) primers were used For GAPDH we ... transcription factors in rheumatic disease Arthritis Rheum 1999, 42:609-621 Chang L, Karin M: Mammalian MAP kinase signalling cascades Nature 2001, 410:37-40 Palanki MS: Inhibitors of AP-1 and...
Ngày tải lên: 09/08/2014, 07:20
Tài liệu Báo cáo khoa học: A role for the intersubunit disulfides of seminal RNase in the mechanism of its antitumor action docx
... repeats Nature 366, 751756 Papageorgiou, A. , Shapiro, R & Acharya, K (1997) Molecular recognition of human angiogenin by placental ribonuclease inhibitor an X-ray crystallographic study at 20 A ... internalization, we investigated the role of plasma membranes (PM) in the transformation of MSSAE into a dimeric protein 125I-labelled MSSAE was incubated with isolated membranes from SVT2 broblasts (0.45 mgặmL)1 ... shows that after incubation with labelled MSSAE, membranes contained radioactive protein both monomeric and dimeric (lane 1) This indicates that under the conditions employed a substantial fraction...
Ngày tải lên: 20/02/2014, 11:20
Context based learning: A role for cinema in science education pdf
... Whereas a dramatic play is realized as a live performance by actors on a stage, a movie is show in a cinema, not as a live event, and can theoretically be repeated infinitely without change Like ... understanding culture and the meanings that culture contains as well participating in social activities (Sormunen and Saari, 2006) The fact that Erin Brockovich was not a lawyer and did not have any ... et al, 2003) 134 Context based learning: A Role for Cinema in Science Education An artistic manifestation, as audiovisual language, shows itself as another possibility or facilitating tool during...
Ngày tải lên: 23/03/2014, 11:21
Báo cáo Y học: Proteolytic action of duodenase is required to induce DNA synthesis in pulmonary artery fibroblasts A role for phosphoinositide 3-kinase pot
... but instead acts as a cofactor for the cleavage and activation of PAR4 [27] Thrombin has been shown to cleave and activate PAR1, PAR3 and PAR4, whereas trypsin cleaves and activates PAR2 As duodenase ... inhibitor) and GF109203X (protein kinase C inhibitor) indicating that each of these pathways has a modulatory rather than a mandatory role to play in mediating the proliferative response In contrast, a ... PAR3 and PAR4 [11] Interestingly, thrombin has now been demonstrated to cleave and activate PAR1, PAR3 and PAR4 whereas trypsin and tryptase activate PAR2 [12] Certain other proteases, including...
Ngày tải lên: 24/03/2014, 03:21
báo cáo hóa học: " A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type 1 by glial cells" pot
... Cambridge, MA), STING (Abcam, Cambridge, MA) or a mouse monoclonal antibody against gG1 (Abnova, Taipei, Taiwan) for 24 hours at 4°C, blots were washed and incubated in the presence of an horseradish ... whole brain samples were performed as described previously by our laboratory [21,23,24] After incubation with a rabbit polyclonal antibody against DAI (Abcam, Cambridge, MA), RIP3 (Abcam, Cambridge, ... Three validated Stealth RNAi™ small interfering (si)RNA duplexes targeting murine DAI, in addition to a universal negative control siRNA that was not homologous to anything in the vertebrate transcriptome,...
Ngày tải lên: 19/06/2014, 22:20
A Role for the International Criminal Court in the Fight against Terrorism? potx
... proceedings before the International Criminal Tribunal for Former Yugoslavia indicate that prosecutions by international criminal tribunals are certainly not always barred by non-cooperative states ... has an important role to play in dealing with acts of internal terrorism targeting a state in political anarchy Inactivity of the international community would necessarily imply a morally unacceptable ... United States and the World need an International Criminal Court as an Ally in the War against Terrorism, Ind Int’l & Comp L Rev 159, 172 (1997) 19 Bryan F MacPherson, An International Criminal Court...
Ngày tải lên: 10/07/2014, 13:21
Báo cáo y học: "Autoantibody profile in systemic lupus erythematosus with psychiatric manifestations: a role for anti-endothelial-cell antibodies" docx
... (Miami, FL, USA) Anti-dsDNA and anti-nucleosome antibodies were obtained from Orgentec Diagnostika (Mainz, Germany) ELISA was performed in accordance with the manufacturer's instructions All assays ... fibrillar acidic protein Human glial fibrillary acidic protein (GFAP) purified from human brain was purchased from Biogenesis (Poole, UK; BH 17 DA) GFAP at µg/ml in carbonate-bicarbonate buffer ... psychiatric manifestations and several autoantibodies (those against endothelial cells, cardiolipin (CL), β2 glycoproteinI (β2-GPI), Ro, La, glial fibrillary acidic protein (GFAP), ribosomal P protein, ...
Ngày tải lên: 09/08/2014, 01:23
Báo cáo khoa học: "Postmastectomy irradiation in breast in breast cancer patients with T1-2 and 1-3 positive axillary lymph nodes: Is there a role for radiation therapy" ppsx
... nodes in the infra or supraclavicular fossa or in the internal mammary chain was considered as a regional recurrence Any recurrence outside these areas was defined as DM Statistical Analysis LRR and ... clear surgical margins (>1 mm) Axillary lymph node staging was performed in all patients Pathological staging was reviewed based on AJCC 2002 The date of evaluation was January 2009 Patient-related ... DMe Alive DM Death DM Death DM Death DM Death DM Alive Out-come a Lateral, bMedial, cInvasive ductal carcinoma, dInvasive Paget’s disease, eDistance metastasis patients had lung metastasis and...
Ngày tải lên: 09/08/2014, 09:20
Báo cáo y học: "A case-control study of rheumatoid arthritis identifies an associated single nucleotide polymorphism in the NCF4 gene, supporting a role for the NADPH-oxidase complex in autoimmunity" doc
... files 12 13 The following Additional files are available online: Additional file An Word file containing a table that shows a table of all SNPs evaluated for association with RA in this study See ... SNP, in order to adjust for age, sex and living area Logistic regression analysis was conducted for a subset of the material, in which all information regarding genetic factors, antibodies and matching ... 71% and 72%, respectively, are female; the mean age was 51 ± 13 years in cases and 54 ± 12 in controls Information about RF and anti-CCP antibody status was available for 1,315 of the patient samples;...
Ngày tải lên: 09/08/2014, 10:21
báo cáo khoa học: " A role for neurotransmission and neurodevelopment in attention‑deficit/hyperactivity disorder" ppsx
... concluded that genetic factors possibly influencing abnormal cerebral lateralization may be involved in ADHD etiology, with BAIAP2 acting specifically in cases of persistent ADHD BAIAP2 is located at ... differentiation (NEUROD6), ATPase, Ca++ transporting plasma membrane (ATP2B3) and inhibitor of DNA binding 2 (ID2) An initial case-control study was con uct d d e in a sample of 587 participants ... 17q25 and encodes the 53 kDa insulin receptor tyrosine kinase substrate protein (IRSp53), a molecule that participates in the signal transduction path ways of insulin and insulin-like growth factors...
Ngày tải lên: 11/08/2014, 12:20
Báo cáo y học: "A role for the histone deacetylase HDAC4 in the life-cycle of HIV-1-based vectors" ppsx
... To quantitate the viral amplicon, a TaqMan dual 5′-6-carboxyfluorescein-and 3′-6-carboxytetramethylrhodamimine-labeled probe was used: 5′-(FAM)-CAGTGGCGCCCGAACAGGGA(TAMRA)-3′ (Integrated DNA Technologies) ... antibodies against HDAC2 and HDAC6, as indicated Terminology as above, * indicates samples from A (C) Effect of an integrase inhibitor on the association of HDAC4 with vector DNA Cells were infected ... foci and confines HDAC4 to the cytoplasm in irradiated non-small cell lung cancer Cancer Res 2006, 66:11298-11304 Daniel R, Katz RA, Skalka AM: A role for DNA-PK in retroviral DNA integration...
Ngày tải lên: 12/08/2014, 01:21
Báo cáo khoa học:" A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" docx
... bp; and 4) gB: forward primer, 5'AACGCGACGCACATCAAG-3', reverse primer, 5'-CTGGTACGCGATCAGAAAGC-3'; and probe, 5'-FAMCAGCCGCAGTACTACC-3' – Amplicon length = 72 bp As an internal control, a set ... STAT1 gene in mice revealed a role for STAT1 in the JAK-STAT signaling pathway [40] The JAK-STAT signaling pathway is involved in mediating biologic responses induced by many cytokines [51] STAT1-deficient ... replication was determined as in Fig Each point represents the mean ± SEM (n = 16) Panel B DNA was isolated and the amount of viral genomic DNA was determined by Taq-Man PCR as described in Materials...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: " A role for the JAK-STAT1 pathway in blocking replication of HSV-1 in dendritic cells and macrophages" pps
... bp; and 4) gB: forward primer, 5'AACGCGACGCACATCAAG-3', reverse primer, 5'-CTGGTACGCGATCAGAAAGC-3'; and probe, 5'-FAMCAGCCGCAGTACTACC-3' – Amplicon length = 72 bp As an internal control, a set ... STAT1 gene in mice revealed a role for STAT1 in the JAK-STAT signaling pathway [40] The JAK-STAT signaling pathway is involved in mediating biologic responses induced by many cytokines [51] STAT1-deficient ... replication was determined as in Fig Each point represents the mean ± SEM (n = 16) Panel B DNA was isolated and the amount of viral genomic DNA was determined by Taq-Man PCR as described in Materials...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo y học: "A role for age-related changes in TGFβ signaling in aberrant chondrocyte differentiation and osteoarthritis" ppt
... Iida A, Sudo A, Miyamoto Y, Fukuda A, Mabuchi A, Kotani A, Kawakami A, Yamamoto S, Uchida A, Nakamura K, Notoya K, Nakamura Y, Ikegawa S: An aspartic acid repeat polymorphism in asporin inhibits ... develop OA starting at the medial tibia from an age of to months The ALK1/ ALK5 ratio was on the medial tibia at an age of months and was 18 in 1-year-old animals The lateral tibia showed a ratio increase ... important signaling pathway for TGFβ, but this is not the only pathway Mitogen-activated protein kinase, Rho-like GTPase and phopshatidylinositol-3-kinase pathways are involved in TGFβ signaling...
Ngày tải lên: 12/08/2014, 11:22
Báo cáo y học: "A role for MCP-1/CCR2 in interstitial lung disease in children" pps
... Ichiyasu H, Yamamoto T, Hiraga Y, Ando M: Measurement of serum monocyte chemoattractant protein1 and its clinical application for estimating the activity of granuloma formation in sarcoidosis Sarcoidosis ... Sarcoidosis American Journal of Respiratory and Critical Care Medicine 1994, 149:655-659 Iyonaga K, Takeya M, Saita N, Sakamoto O, Yoshimura T, Ando M, et al.: Monocyte Chemoattractant Protein- 1 ... Malur A, Barna BP, Culver DA, Kavuru MS, et al.: Elevated monocyte chemotactic proteins 1, 2, and in pulmonary alveolar proteinosis are associated with chemokine receptor suppression Clinical...
Ngày tải lên: 12/08/2014, 18:22