a role for aesthetics in consumer psychology
Context based learning: A role for cinema in science education pdf
Ngày tải lên :
23/03/2014, 11:21
... Whereas a dramatic play is realized as a live performance by actors on a stage, a movie is show in a cinema, not as a live event, and can theoretically be repeated infinitely without change Like ... understanding culture and the meanings that culture contains as well participating in social activities (Sormunen and Saari, 2006) The fact that Erin Brockovich was not a lawyer and did not have any ... et al, 2003) 134 Context based learning: A Role for Cinema in Science Education An artistic manifestation, as audiovisual language, shows itself as another possibility or facilitating tool during...
- 13
- 508
- 0
Báo cáo y học: "Bench to bedside: A role for erythropoietin in sepsis" pps
Ngày tải lên :
13/08/2014, 20:22
... norepinephrine in renal failure Kidney Int 1995, 48:806-813 65 Allegra A, Galasso A, Siracusano L, Aloisi C, Corica F, Lagana A, Frisina N, Buemi M: Administration of recombinant erythropoietin ... Veldhuisen DJ: A single bolus of a long-acting erythropoietin analogue darbepoetin alfa in patients with acute myocardial infarction: a randomized feasibility and safety study Cardiovasc Drugs Ther ... lymphocyte Nat Immunol 2000, 1:496-501 Kawasaki M, Kuwano K, Hagimoto N, Matsuba T, Kunitake R, Tanaka T, Maeyama T, Hara N: Protection from lethal apoptosis in lipopolysaccharideinduced acute lung injury...
- 8
- 245
- 0
Báo cáo y học: "A role for Numb in p53 stabilization" pps
Ngày tải lên :
14/08/2014, 08:21
... than initially thought The well characterized binding between the amino termini of the two proteins causes a conformational change, which allows binding between the DNA-binding domain of p53 and ... finger-ribosomal protein inter actions Cell Cycle 2007, 6:434-437 23 Itahana K, Mao H, Jin A, Itahana Y, Clegg HV, Lindstrom MS, Bhat KP, Godfrey VL, Evan GI, Zhang Y: Targeted inactivation of Mdm2 RING finger ... interaction with the ubiquitin ligase Itch It is interesting to note that rather than inhibiting ubiquitination, Numb can enhance the degradation of Gli1 by Itch - again pointing to a rather specific effect...
- 3
- 237
- 0
Tài liệu Báo cáo khoa học: A role for the intersubunit disulfides of seminal RNase in the mechanism of its antitumor action docx
Ngày tải lên :
20/02/2014, 11:20
... repeats Nature 366, 751756 Papageorgiou, A. , Shapiro, R & Acharya, K (1997) Molecular recognition of human angiogenin by placental ribonuclease inhibitor an X-ray crystallographic study at 20 A ... labelled protein was then analyzed by SDS/PAGE followed by autoradiography The results shown in Fig indicate that MSSAE monomers upon binding to the cell surface associate into a dimeric protein, with ... internalization, we investigated the role of plasma membranes (PM) in the transformation of MSSAE into a dimeric protein 125I-labelled MSSAE was incubated with isolated membranes from SVT2 broblasts (0.45 mgặmL)1...
- 8
- 604
- 0
Báo cáo khoa học: A role for serglycin proteoglycan in granular retention and processing of mast cell secretory granule components ppt
Ngày tải lên :
07/03/2014, 11:20
... seen after 26 days of culture mMCP-6 storage showed similar kinetics as for mMCP-5 In contrast, CPA protein was detected as early as after days of culture, and a maximal plateau of storage was already ... Although b-hexosaminidase activity was already detected at day 0, the intracellular content of this enzyme increased markedly after days of culture, and reached a plateau from about day 12 (Fig 2B) ... metachromatically staining granules seen in mature MCs have been poorly investigated In a recent study, we generated a mouse strain in which the SG gene was targeted [10] We found that, in the absence...
- 12
- 438
- 0
Báo cáo khoa học: A pre-docking role for microtubules in insulin-stimulated glucose transporter 4 translocation ppt
Ngày tải lên :
16/03/2014, 06:20
... has a functional Rab GTPase-activating protein domain Biochem J 391, 87–93 Larance M, Ramm G, Stockli J, van Dam EM, Winata S, Wasinger V, Simpson F, Graham M, Junutula JR, Guilhaus M et al (2005) ... Kane S, Sano H, Liu SC, Asara JM, Lane WS, Garner CC & Lienhard GE (2002) A method to identify serine kinase substrates Akt phosphorylates a novel adipocyte protein with a Rab GTPase-activating ... (1996) Activated phosphatidylinositol 3-kinase is sufficient to mediate actin rearrangement and GLUT4 translocation in 3T3-L1 adipocytes J Biol Chem 271, 17605–17608 Okada T, Kawano Y, Sakakibara T,...
- 8
- 420
- 0
Báo cáo Y học: Proteolytic action of duodenase is required to induce DNA synthesis in pulmonary artery fibroblasts A role for phosphoinositide 3-kinase pot
Ngày tải lên :
24/03/2014, 03:21
... but instead acts as a cofactor for the cleavage and activation of PAR4 [27] Thrombin has been shown to cleave and activate PAR1, PAR3 and PAR4, whereas trypsin cleaves and activates PAR2 As duodenase ... inhibitor) and GF109203X (protein kinase C inhibitor) indicating that each of these pathways has a modulatory rather than a mandatory role to play in mediating the proliferative response In contrast, a ... PAR3 and PAR4 [11] Interestingly, thrombin has now been demonstrated to cleave and activate PAR1, PAR3 and PAR4 whereas trypsin and tryptase activate PAR2 [12] Certain other proteases, including...
- 10
- 437
- 0
báo cáo hóa học: " A role for DNA-dependent activator of interferon regulatory factor in the recognition of herpes simplex virus type 1 by glial cells" pot
Ngày tải lên :
19/06/2014, 22:20
... Cambridge, MA), STING (Abcam, Cambridge, MA) or a mouse monoclonal antibody against gG1 (Abnova, Taipei, Taiwan) for 24 hours at 4°C, blots were washed and incubated in the presence of an horseradish ... whole brain samples were performed as described previously by our laboratory [21,23,24] After incubation with a rabbit polyclonal antibody against DAI (Abcam, Cambridge, MA), RIP3 (Abcam, Cambridge, ... Three validated Stealth RNAi™ small interfering (si)RNA duplexes targeting murine DAI, in addition to a universal negative control siRNA that was not homologous to anything in the vertebrate transcriptome,...
- 12
- 529
- 0
A Role for the International Criminal Court in the Fight against Terrorism? potx
Ngày tải lên :
10/07/2014, 13:21
... proceedings before the International Criminal Tribunal for Former Yugoslavia indicate that prosecutions by international criminal tribunals are certainly not always barred by non-cooperative states ... has an important role to play in dealing with acts of internal terrorism targeting a state in political anarchy Inactivity of the international community would necessarily imply a morally unacceptable ... United States and the World need an International Criminal Court as an Ally in the War against Terrorism, Ind Int’l & Comp L Rev 159, 172 (1997) 19 Bryan F MacPherson, An International Criminal Court...
- 53
- 449
- 1
Báo cáo y học: "Autoantibody profile in systemic lupus erythematosus with psychiatric manifestations: a role for anti-endothelial-cell antibodies" docx
Ngày tải lên :
09/08/2014, 01:23
... (Miami, FL, USA) Anti-dsDNA and anti-nucleosome antibodies were obtained from Orgentec Diagnostika (Mainz, Germany) ELISA was performed in accordance with the manufacturer's instructions All assays ... Franceschini F, Cavazzana I, Origgi L, Vanoli M, Bozzolo E, Ferrario L, Padovani A, Gambini O, Vanzulli L, Croce D, Bombardieri S: Clinical and serological associations of ribosomal P autoantibodies in ... erythematosus: prospective evaluation in a large cohort of Italian patients Rheumatology 2002, 41:1357-1366 51 Yoshio T, Masuyama J, Ikeda M, Tamai K, Hachiya T, Emori T, Mimori A, Takeda A, Minota...
- 7
- 431
- 0
Báo cáo y học: "A proinflammatory role for Fas in joints of mice with collagen-induced arthritis" docx
Ngày tải lên :
09/08/2014, 01:23
... The measurements were made in triplicate Histopathological analysis of joints Histopathological features of peripheral joints were assessed in hematoxylin-stained formalin-fixed paraffinembedded ... 99:245-250 Sakata K, Sakata A, Vela-Roch N, Espinosa R, Escalante A, Kong L, Nakabayashi T, Cheng J, Talal N, Dang H: Fas (CD95)-transduced signal preferentially stimulates lupus peripheral T lymphocytes ... an allelic combination derived from the original inbred strains Arthritis Rheum 2002, 46:1067-1074 Sugiyama M, Tsukazaki T, Yonekura A, Matsuzaki S, Yamashita S, Iwasaki K: Localization of apoptosis...
- 11
- 469
- 0
Báo cáo y học: "A model of inflammatory arthritis highlights a role for oncostatin M in pro-inflammatory cytokine-induced bone destruction via RANK/RANK" pps
Ngày tải lên :
09/08/2014, 06:22
... causes profound bone damage with osteoclast formation and activation, and increased expression of RANK/ RANKL in inflammatory cells, in inflamed synovium, in articular cartilage and at the invading ... differentiation and activation induced by osteoprotegerin ligand Proc Natl Acad Sci USA 1999, 96:3540-3545 Kobayashi K, Takahashi N, Jimi E, Udagawa N, Takami M, Kotake S, Nakagawa N, Kinosaki M, Yamaguchi ... corresponding to amino acids 317–616 mapping at the carboxy terminus of RANK of human origin [H-300]) or against RANKL (rabbit polyclonal antibody raised against the epitope corresponding to amino acids...
- 8
- 380
- 0
Báo cáo y học: " Tumour necrosis factor-α stimulates dehydroepiandrosterone metabolism in human fibroblast-like synoviocytes: a role for nuclear factor-κB and activator protein-1 in the regulation of expression of cytochrome p450 enzyme 7b" doc
Ngày tải lên :
09/08/2014, 07:20
... transduction pathway is involved in the TNF-α-mediated increase in Cyp7b activity in human FLS Signaling pathways that mediate the effects of TNF-α include mitogen-activated protein kinases (MAPKs) and ... Netherlands) and reverse transcriptase (Pharmacia) For reverse transcription PCR, human Cyp7b sense (GTCCTGGAGAAATATTATGTGCAG) and antisense (CGCACACAGTAGTCCCCGG) primers were used For GAPDH we ... transcription factors in rheumatic disease Arthritis Rheum 1999, 42:609-621 Chang L, Karin M: Mammalian MAP kinase signalling cascades Nature 2001, 410:37-40 Palanki MS: Inhibitors of AP-1 and...
- 10
- 462
- 0
Báo cáo y học: "A cell-cycle independent role for p21 in regulating synovial fibroblast migration in rheumatoid arthritis" pps
Ngày tải lên :
09/08/2014, 08:22
... FLS chemotaxis assays; Ross Sherban for assistance with helping obtain IRB approval and delivery of RA SFs; and Jerome Radliff III for technical assistance in counting chemotaxis assays References ... overlapping pathways suppressing tumorigenesis in mice Proc Natl Acad Sci USA 1999, 96:6382-6387 Nakayama K, Ishida N, Shirane M, Inomata A, Inoue T, Shishido N, Horii I, Loh DY, Nakayama K-I: ... fold-increase over background migration to PBS (negative control) An asterisk indicates a statistically significant difference Combined chemotaxis data analyzed from seven separate patients in nine independent...
- 8
- 368
- 0
Báo cáo khoa học: "Postmastectomy irradiation in breast in breast cancer patients with T1-2 and 1-3 positive axillary lymph nodes: Is there a role for radiation therapy" ppsx
Ngày tải lên :
09/08/2014, 09:20
... nodes in the infra or supraclavicular fossa or in the internal mammary chain was considered as a regional recurrence Any recurrence outside these areas was defined as DM Statistical Analysis LRR and ... clear surgical margins (>1 mm) Axillary lymph node staging was performed in all patients Pathological staging was reviewed based on AJCC 2002 The date of evaluation was January 2009 Patient-related ... DMe Alive DM Death DM Death DM Death DM Death DM Alive Out-come a Lateral, bMedial, cInvasive ductal carcinoma, dInvasive Paget’s disease, eDistance metastasis patients had lung metastasis and...
- 8
- 357
- 0
Báo cáo y học: "A case-control study of rheumatoid arthritis identifies an associated single nucleotide polymorphism in the NCF4 gene, supporting a role for the NADPH-oxidase complex in autoimmunity" doc
Ngày tải lên :
09/08/2014, 10:21
... files 12 13 The following Additional files are available online: Additional file An Word file containing a table that shows a table of all SNPs evaluated for association with RA in this study See ... SNP, in order to adjust for age, sex and living area Logistic regression analysis was conducted for a subset of the material, in which all information regarding genetic factors, antibodies and matching ... 71% and 72%, respectively, are female; the mean age was 51 ± 13 years in cases and 54 ± 12 in controls Information about RF and anti-CCP antibody status was available for 1,315 of the patient samples;...
- 11
- 475
- 0
Báo cáo y học: "Elevated extracellular matrix production and degradation upon bone morphogenetic protein-2 (BMP-2) stimulation point toward a role for BMP-2 in cartilage repair and remodeling" pps
Ngày tải lên :
09/08/2014, 10:21
... CCCCGAGGGCTGTGCTA TGAACTTCAACTGGAACAGGGTATC Aggrecan 0.992 2.15 TCTACCCCAACCAAACCGG AGGCATGGTGCTTTGACAGTG Collagen X 0.992 1.97 CACACTCTGTCCTCGTGCTTTG GGAATCCCTGTAAGACACACCAA Mice were injected intraperitoneally ... Therefore, the safranin O staining intensity was scored in patellar and tibial cartilage with a computerized imaging system There was a significant (30%) increase in safranin O staining intensity ... stimulation also leads to increased VDIPEN staining (k) and NITEGE staining (q,p) Arrows point to intense staining around chondrocytes FastG, fast green; SafO, safranin O Co-incubation of several...
- 11
- 401
- 0
Báo cáo y học: "Identification of possible candidate genes regulating Sjögren''''s syndrome-associated autoimmunity: a potential role for TNFSF4 in autoimmune exocrinopathy" docx
Ngày tải lên :
09/08/2014, 13:22
... Kit (Qiagen Inc., Valencia, CA, USA) from a small tail snip taken between and weeks of age just prior to weaning Each DNA sample was used as a template in polymerase chain reaction amplification ... recombinant founder pair was identified, the RI line was maintained via a single line of descent All RI lines were bred and maintained under specific pathogenfree conditions in the animal facility ... presence of ANAs, in particular anti-SS -A/ Ro and antiSS-B/La in the sera of human patients, is one parameter in the diagnosis of clinical SjS Concomitantly with the appearance of mononuclear leukocytes...
- 12
- 399
- 0
báo cáo khoa học: " Molecular, genetic and transcriptional evidence for a role of VvAGL11 in stenospermocarpic seedlessness in grapevine" pptx
Ngày tải lên :
11/08/2014, 11:21
... 5-AAGCCAAGGAATCACCCATT-3; for the internal reference gene EF1 -a (GSVIVT00024496001-8.4x) the oligos are 5-AGGATGGACAAACCCGTGAG-3 and 5-AAGCCAGAGATGGGGACAAA-3, and the amplicons have a predicted ... both parental Page of 18 linkage maps (Additional file 3) The mapping data set for LG 18 in Ruby Seedless (RS) and Sultanina (S) included a total of 27 co-dominant markers (Additional file 4), among ... 2B and Additional file 3) An INDEL revealed by p1_VvAGL11 affects a putative O2-like box, p2_VvAGL11 marks a putative TATA-box near far the transcription start site and p3_VvAGL11 marks a (GAGA)n...
- 19
- 389
- 0