... modal auxiliaries and modality in Vietnamese, it is necessary to present here some features that are peculiar to the Vietnamese language as these features are reflected via the modal auxiliaries ... to have a contrastive analysisofthe meanings expressed via the modal verbs can, may, must and the equivalent expressions in Vietnamese Theanalysis has shown that there occurs a few modal verb ... is rendered in language B He considers CA as a form of interlanguage study and as a central and substantial component of applied linguistics As a matter of fact, CA has had much to offer to practical...
... described above for flow cytometry After establishing a scan area, the slides were analyzed using a 40 · objective and mW of Argon laser power The entire cell preparation was examined A cell gallery was ... experimental data to a logistic regression The surviving fraction of cells (SF) was calculated as: TD50 untreated/ TD50 WP631-treated cells Results Proliferation of Jurkat cells treated with a range of ... absorption of WP631 Two approaches were used, which take advantage ofthe fluorescence of anthracyclines The absorbed daunorubicin or WP631 were quantified by spectrofluorecence analysisof lysates of cells...
... long-term analysis we assume the structure ofthe agricultural economy in the United States remains stable That is, the role of energy in agriculture remains the same over time The relation between ... by Region (based on carbon price of $34/MT CO2e) Pacific Mountain Delta States South East Afforestation from cropland Appalachia Afforestation from pasture Great Plains Corn Belt Tillage changes ... assembled of presumptively eligible EITE sectors Additionally, EPA analysis indicates that the allocation formula would provide enough allowances to cover the increased energy costs of all presumptively...
... PH17P(+) PA55G()) PA55G(+) PT69G()) PT69G(+) TTGTACGTTGCGAACAACCCCGGACAAT ATTGTCCGGGGTTGTTCGCAACGTACAA TTGTACGTTGCAATCAACCCCGGACAAT ATTGTCCGGGGTTGATTGCAACGTACAA ACCACAGGTGTTGTACATTGCGATCAACC GGTTGATCGCAATGTACAACACCTGTGGT ... GGTTGATCGCAATGTACAACACCTGTGGT TCCTACCGCAGGTCCTGAGCAGCAGGGA TCCCTGCTGCTCAGGACCTGCGGTAGGA TTTGCCCGCACTGGCGGCTTTGCGGTGTC GACACCGCAAAGCCGCCAGTGCGGGCAAA TTGGCATACGTACCACAGGTGTTGTAC GTACAACACCTCCGGTACGTATGCCAA ... RNA products was based on three independent measurements, using the standard deviation as the errors bars Statistical analysis All the data are represented by at least three independent measurements...
... simplicity that the marginal costs are zero, and therefore the prices are the same as margins In a more general case, it can be shown that for small packages to be profitable, we require that s∗ l∗ p1 ... Amaldoss; Ram Janakiraman; Ambar Rao; seminar participants at the University of Arizona, University of British Columbia, University of Texas at Austin, University of Texas at Dallas, and Washington ... large package In this case, note that two small packages are equivalent to a large package.14 With this assumption, theanalysis with small packages is similar to the case when the firm only offers...
... have undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore ... fiscal year 2001/2 by an Act of Parliament to manage the National AIDS Fund In addition to the allocations to the Ministry of Health and Social Welfare, the Ministry of Finance also makes (smaller) ... In the literature it has been estimated that sub-Saharan Africa requires US$4.6 billion annually for prevention, care and support, and treatment (including anti-retroviral therapy) Given that these...
... following the distarget (These features will prove important informats, there are extra bits which have no software or hardware The standard supports masscussion ofassigned functions These are labeled ... jamming requires only the transmission ofa signal at a level near that ofthe legitimate transmitter Competing signals arriving at the receiver will prevent clean decoding As a practical matter, ... that it effectively has more than 14dB of average power advantage over the legitimate transmitter It may be possible to improve the advantage to the jammer even more by careful analysisof the...
... California, Hawaii, Kansas, and Nevada all temporarily increased the sales tax Other Notable Changes • A dozen states either adopted an “Amazon” law or reached an agreement with the online retailer ... are capital gains tax breaks (Arizona, Arkansas, Hawaii, Montana, New Mexico, North Dakota, South Carolina, and Vermont) and deductions for federal income taxes paid (Alabama, Iowa, Louisiana, ... State lawmakers have enacted a wide variety of tax changes over the past three years since the last publication of Who Pays Many of these changes have dramatically reshaped state and local tax...
... Mortgage bonds AAA AA A BBB BB-unrated 80% 11% 4% 3% 2% CLO 36% Mezzanine CDO Senior AAA 62% Junior AAA 14% AA 8% A 6% BBB 6% Unrated 4% CDO-squared (CDO of CDO) Senior AAA Junior AAA AA A BBB ... the share that is owned These arrangements may also be structured as shared appreciation mortgages, in which the lender agrees to a below-market interest rate in exchange for a share ofthe appreciated ... share ofthe appreciated value ofthe collateral property The share ofthe appreciated value is determined and due at the sale ofthe property or at the termination ofthe mortgage In addition to...
... gene signaling pathway analysis has identified gene signals that are remarkably activated in AT-MSC-Hepa, and these signals are also up-regulated in whole liver Therefore, the microarray analysis ... protocol, and then treated with deoxyribonuclease (DNase I, amplification grade; TaKaRa, Kyoto, Japan) Microarray analysis and data mining (Aligent array) A one-color microarray-based gene expression analysis ... categories were assigned to genes based on the acegene microarray database (DNA Chip Research Inc and Hitachi Software Co., Yokohama, Japan) The significance of GO term appearance in the up- and...
... have undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore ... fiscal year 2001/2 by an Act of Parliament to manage the National AIDS Fund In addition to the allocations to the Ministry of Health and Social Welfare, the Ministry of Finance also makes (smaller) ... In the literature it has been estimated that sub-Saharan Africa requires US$4.6 billion annually for prevention, care and support, and treatment (including anti-retroviral therapy) Given that these...
... have undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore ... fiscal year 2001/2 by an Act of Parliament to manage the National AIDS Fund In addition to the allocations to the Ministry of Health and Social Welfare, the Ministry of Finance also makes (smaller) ... In the literature it has been estimated that sub-Saharan Africa requires US$4.6 billion annually for prevention, care and support, and treatment (including anti-retroviral therapy) Given that these...
... Reproduced with permission ofthe copyright owner Further reproduction prohibited without permission Reproduced with permission ofthe copyright owner Further reproduction prohibited ... without permission Reproduced with permission ofthe copyright owner Further reproduction prohibited without permission Reproduced with permission ofthe copyright owner Further reproduction prohibited ... without permission Reproduced with permission ofthe copyright owner Further reproduction prohibited without permission Reproduced with permission ofthe copyright owner Further reproduction prohibited...
... consistency ofthe scales by means of Cronbach's alpha The ultimate score that each nurse received for each factor was based on the simple summation ofthe item scores for that measure Mean factor scores ... between respondents and a sample of primary responders suggests that non-response bias was minimal and the sample was therefore representative of all professional nurses in South Africa Results ... Pillay R: Effect of organisational structure and managerial practices on the clinical behavior and job satisfaction of primary healthcare doctors as knowledge workers, in the managed healthcare...
... studies Theanalysis revealed several characteristic features with respect to the individual amino acids in the Vpr Ofthe 96 amino acids, all the amino acids except the initiator methionine have the ... emergence of genetic variants is a characteristic feature of RNA viruses RNA dependent RNA polymerase and reverse transcriptase are error-prone Table 12: The frequency of variant amino acids in Helical ... targeting these enzymes The viruses containing alterations may then be able to evade the inhibitory activities ofthe agents and are designated as drug-resistant variants Similarly, the mutations...
... phenomenon) As an incident wave impinges on the cylinder, a reflected wave moves outward On the sheltered side ofthe cylinder there will be a “shadow” zone where the wave fronts are bent around the ... (1978) and Ohkusu (1974) As the wave number ka increases The wave forces on the cylinders oscillate around the wave forces on an isolated cylinder As the cylinder spacing increases, the wave ... Conclusions and Remarks The wave forces acting on two cylinders and three cylinders are computed by using boundary element method The numerical results are in good agreement with those of Chakrabarti...
... is a measure or process that changes with the mass ofthe larva and for which the larva can measure the ratio between the current state and the state at the beginning ofthe instar Stretch reception ... growth rate on peak size in the presence ofa small amount of random variation in all other parameter values Variation in the generating parameters masks the sawtooth character ofthe ‘ideal’ relationship ... their growth parameters ‘Empirical data’ are from Table Bars are standard deviations (with standard deviations 8% of means, as before) on the other parameters, using the T strain parameter values...
... vertices and i colored leaves ofthe first class, we attach β leaves to its candidate leaf and erase the color ofthe candidate leaf (now an internal vertex) Thus we obtain a β-ary tree with n ... Riordan array theory and Lagrange inversion formula We present the following theorem easily derived from Theorem 2.1–2.4 in the paper [5] Theorem 3.3 (modified Riordan array theorem) Let A( x) = a0 ... in a very recent paper of Bajunaid et al [1, 2005] They claimed that they did not find their result in the literature and they did not know any obvious combinatorial proof for their special case,...
... exception, an SIR of 1.68, was in a Japanese population and the authors state that they observed a generally higher risk of malignancies in Japanese women with RA than that reported in comparable Caucasian ... analysis evaluated malignancy risk in an identified early RA population [4,5,8,9] Askling and colleagues [4,5] found an increased risk of lymphoma and lung cancer and a decreased risk of breast ... non-Hodgkin, and a potential decrease in risks of colorectal cancer and breast cancer The increased risk of lymphoma is especially notable since this malignancy was associated with the highest relative...
... meta -analysis of all randomised controlled trials (RCTs) of pharmacological and non-pharmacological treatments that are available in standard primary care settings and those that are administered ... pharmacological treatments and primary care • We recalculated the meta -analysis excluding these two studies and the results were the same: there were no significant differences in the efficacy ofthe treatments ... fibromyalgia when comparing primary care and specialised care Our meta -analysis demonstrates that there are no differences in the overall outcome of fibromyalgia regardless ofthe level of care in...