... modal auxiliaries and modality in Vietnamese, it is necessary to present here some features that are peculiar to the Vietnamese language as these features are reflected via the modal auxiliaries ... to have a contrastive analysis of the meanings expressed via the modal verbs can, may, must and the equivalent expressions in Vietnamese The analysis has shown that there occurs a few modal verb ... is rendered in language B He considers CA as a form of interlanguage study and as a central and substantial component of applied linguistics As a matter of fact, CA has had much to offer to practical...
Ngày tải lên: 29/01/2014, 00:23
... described above for flow cytometry After establishing a scan area, the slides were analyzed using a 40 · objective and mW of Argon laser power The entire cell preparation was examined A cell gallery was ... experimental data to a logistic regression The surviving fraction of cells (SF) was calculated as: TD50 untreated/ TD50 WP631-treated cells Results Proliferation of Jurkat cells treated with a range of ... absorption of WP631 Two approaches were used, which take advantage of the fluorescence of anthracyclines The absorbed daunorubicin or WP631 were quantified by spectrofluorecence analysis of lysates of cells...
Ngày tải lên: 20/02/2014, 23:20
Tài liệu A PRELIMINARY ANALYSIS OF THE EFFECTS OF HR 2454 ON U.S. AGRICULTURE doc
... long-term analysis we assume the structure of the agricultural economy in the United States remains stable That is, the role of energy in agriculture remains the same over time The relation between ... by Region (based on carbon price of $34/MT CO2e) Pacific Mountain Delta States South East Afforestation from cropland Appalachia Afforestation from pasture Great Plains Corn Belt Tillage changes ... assembled of presumptively eligible EITE sectors Additionally, EPA analysis indicates that the allocation formula would provide enough allowances to cover the increased energy costs of all presumptively...
Ngày tải lên: 21/02/2014, 01:20
Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx
... PH17P(+) PA55G()) PA55G(+) PT69G()) PT69G(+) TTGTACGTTGCGAACAACCCCGGACAAT ATTGTCCGGGGTTGTTCGCAACGTACAA TTGTACGTTGCAATCAACCCCGGACAAT ATTGTCCGGGGTTGATTGCAACGTACAA ACCACAGGTGTTGTACATTGCGATCAACC GGTTGATCGCAATGTACAACACCTGTGGT ... GGTTGATCGCAATGTACAACACCTGTGGT TCCTACCGCAGGTCCTGAGCAGCAGGGA TCCCTGCTGCTCAGGACCTGCGGTAGGA TTTGCCCGCACTGGCGGCTTTGCGGTGTC GACACCGCAAAGCCGCCAGTGCGGGCAAA TTGGCATACGTACCACAGGTGTTGTAC GTACAACACCTCCGGTACGTATGCCAA ... RNA products was based on three independent measurements, using the standard deviation as the errors bars Statistical analysis All the data are represented by at least three independent measurements...
Ngày tải lên: 16/03/2014, 03:20
Marketing of Vice Goods: A Strategic Analysis of the Package Size Decision pdf
... simplicity that the marginal costs are zero, and therefore the prices are the same as margins In a more general case, it can be shown that for small packages to be profitable, we require that s∗ l∗ p1 ... Amaldoss; Ram Janakiraman; Ambar Rao; seminar participants at the University of Arizona, University of British Columbia, University of Texas at Austin, University of Texas at Dallas, and Washington ... large package In this case, note that two small packages are equivalent to a large package.14 With this assumption, the analysis with small packages is similar to the case when the firm only offers...
Ngày tải lên: 16/03/2014, 11:20
A Comparative Analysis of the Financing of HIV/AIDS Programmes docx
... have undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore ... fiscal year 2001/2 by an Act of Parliament to manage the National AIDS Fund In addition to the allocations to the Ministry of Health and Social Welfare, the Ministry of Finance also makes (smaller) ... In the literature it has been estimated that sub-Saharan Africa requires US$4.6 billion annually for prevention, care and support, and treatment (including anti-retroviral therapy) Given that these...
Ngày tải lên: 22/03/2014, 18:20
Why (Special Agent) Johnny (Still) Can’t Encrypt: A Security Analysis of the APCO Project 25 Two-Way Radio System docx
... following the distarget (These features will prove important informats, there are extra bits which have no software or hardware The standard supports masscussion ofassigned functions These are labeled ... jamming requires only the transmission of a signal at a level near that of the legitimate transmitter Competing signals arriving at the receiver will prevent clean decoding As a practical matter, ... that it effectively has more than 14dB of average power advantage over the legitimate transmitter It may be possible to improve the advantage to the jammer even more by careful analysis of the...
Ngày tải lên: 23/03/2014, 13:20
Who Pays? A Distributional Analysis of the Tax Systems in All 50 States docx
... California, Hawaii, Kansas, and Nevada all temporarily increased the sales tax Other Notable Changes • A dozen states either adopted an “Amazon” law or reached an agreement with the online retailer ... are capital gains tax breaks (Arizona, Arkansas, Hawaii, Montana, New Mexico, North Dakota, South Carolina, and Vermont) and deductions for federal income taxes paid (Alabama, Iowa, Louisiana, ... State lawmakers have enacted a wide variety of tax changes over the past three years since the last publication of Who Pays Many of these changes have dramatically reshaped state and local tax...
Ngày tải lên: 23/03/2014, 20:20
The Rise and Fall of the U.S. Mortgage and Credit Markets: A Comprehensive Analysis of the Meltdown pot
... Mortgage bonds AAA AA A BBB BB-unrated 80% 11% 4% 3% 2% CLO 36% Mezzanine CDO Senior AAA 62% Junior AAA 14% AA 8% A 6% BBB 6% Unrated 4% CDO-squared (CDO of CDO) Senior AAA Junior AAA AA A BBB ... the share that is owned These arrangements may also be structured as shared appreciation mortgages, in which the lender agrees to a below-market interest rate in exchange for a share of the appreciated ... share of the appreciated value of the collateral property The share of the appreciated value is determined and due at the sale of the property or at the termination of the mortgage In addition to...
Ngày tải lên: 29/03/2014, 07:20
Báo cáo khoa học: A comparative analysis of the transcriptome and signal pathways in hepatic differentiation of human adipose mesenchymal stem cells doc
... gene signaling pathway analysis has identified gene signals that are remarkably activated in AT-MSC-Hepa, and these signals are also up-regulated in whole liver Therefore, the microarray analysis ... protocol, and then treated with deoxyribonuclease (DNase I, amplification grade; TaKaRa, Kyoto, Japan) Microarray analysis and data mining (Aligent array) A one-color microarray-based gene expression analysis ... categories were assigned to genes based on the acegene microarray database (DNA Chip Research Inc and Hitachi Software Co., Yokohama, Japan) The significance of GO term appearance in the up- and...
Ngày tải lên: 30/03/2014, 04:20
A Comparative Analysis of the Financing of HIV_AIDS Programmes doc
... have undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore ... fiscal year 2001/2 by an Act of Parliament to manage the National AIDS Fund In addition to the allocations to the Ministry of Health and Social Welfare, the Ministry of Finance also makes (smaller) ... In the literature it has been estimated that sub-Saharan Africa requires US$4.6 billion annually for prevention, care and support, and treatment (including anti-retroviral therapy) Given that these...
Ngày tải lên: 30/03/2014, 07:20
A Comparative Analysis of the Financing of HIV_AIDS Programmes potx
... have undertaken a ‘National HIV/AIDS Accounts’, as has been done in other countries such as: Rwanda, Argentina, Brazil, and other Latin American and Caribbean countries The data are therefore ... fiscal year 2001/2 by an Act of Parliament to manage the National AIDS Fund In addition to the allocations to the Ministry of Health and Social Welfare, the Ministry of Finance also makes (smaller) ... In the literature it has been estimated that sub-Saharan Africa requires US$4.6 billion annually for prevention, care and support, and treatment (including anti-retroviral therapy) Given that these...
Ngày tải lên: 30/03/2014, 07:20
a comparative analysis of the cognitive moral development of independent public auditors in selected public accounting firms and bank examiners in selected federal banking regulatory agencies
... Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited ... without permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited ... without permission Reproduced with permission of the copyright owner Further reproduction prohibited without permission Reproduced with permission of the copyright owner Further reproduction prohibited...
Ngày tải lên: 03/06/2014, 02:11
báo cáo sinh học:" Work satisfaction of professional nurses in South Africa: a comparative analysis of the public and private sectors Rubin Pillay" pot
... consistency of the scales by means of Cronbach's alpha The ultimate score that each nurse received for each factor was based on the simple summation of the item scores for that measure Mean factor scores ... between respondents and a sample of primary responders suggests that non-response bias was minimal and the sample was therefore representative of all professional nurses in South Africa Results ... Pillay R: Effect of organisational structure and managerial practices on the clinical behavior and job satisfaction of primary healthcare doctors as knowledge workers, in the managed healthcare...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo hóa học: " A comprehensive analysis of the naturally occurring polymorphisms in HIV-1 Vpr: Potential impact on CTL epitopes" doc
... studies The analysis revealed several characteristic features with respect to the individual amino acids in the Vpr Of the 96 amino acids, all the amino acids except the initiator methionine have the ... emergence of genetic variants is a characteristic feature of RNA viruses RNA dependent RNA polymerase and reverse transcriptase are error-prone Table 12: The frequency of variant amino acids in Helical ... targeting these enzymes The viruses containing alterations may then be able to evade the inhibitory activities of the agents and are designated as drug-resistant variants Similarly, the mutations...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo chuyên đề xây dựng " A Numerical Analysis of The Wave Forces on Vertical Cylinders by Boundary Element Method " potx
... phenomenon) As an incident wave impinges on the cylinder, a reflected wave moves outward On the sheltered side of the cylinder there will be a “shadow” zone where the wave fronts are bent around the ... (1978) and Ohkusu (1974) As the wave number ka increases The wave forces on the cylinders oscillate around the wave forces on an isolated cylinder As the cylinder spacing increases, the wave ... Conclusions and Remarks The wave forces acting on two cylinders and three cylinders are computed by using boundary element method The numerical results are in good agreement with those of Chakrabarti...
Ngày tải lên: 26/07/2014, 07:20
Báo cáo sinh học: "A quantitative analysis of the mechanism that controls body size in Manduca sexta" docx
... is a measure or process that changes with the mass of the larva and for which the larva can measure the ratio between the current state and the state at the beginning of the instar Stretch reception ... growth rate on peak size in the presence of a small amount of random variation in all other parameter values Variation in the generating parameters masks the sawtooth character of the ‘ideal’ relationship ... their growth parameters ‘Empirical data’ are from Table Bars are standard deviations (with standard deviations 8% of means, as before) on the other parameters, using the T strain parameter values...
Ngày tải lên: 06/08/2014, 18:21
Báo cáo toán học: "A refinement of the formula for k-ary trees and the Gould-Vandermonde’s convolution" pps
... vertices and i colored leaves of the first class, we attach β leaves to its candidate leaf and erase the color of the candidate leaf (now an internal vertex) Thus we obtain a β-ary tree with n ... Riordan array theory and Lagrange inversion formula We present the following theorem easily derived from Theorem 2.1–2.4 in the paper [5] Theorem 3.3 (modified Riordan array theorem) Let A( x) = a0 ... in a very recent paper of Bajunaid et al [1, 2005] They claimed that they did not find their result in the literature and they did not know any obvious combinatorial proof for their special case,...
Ngày tải lên: 07/08/2014, 15:23
Báo cáo y học: "A meta-analysis of the incidence of malignancy in adult patients with rheumatoid arthritis" doc
... exception, an SIR of 1.68, was in a Japanese population and the authors state that they observed a generally higher risk of malignancies in Japanese women with RA than that reported in comparable Caucasian ... analysis evaluated malignancy risk in an identified early RA population [4,5,8,9] Askling and colleagues [4,5] found an increased risk of lymphoma and lung cancer and a decreased risk of breast ... non-Hodgkin, and a potential decrease in risks of colorectal cancer and breast cancer The increased risk of lymphoma is especially notable since this malignancy was associated with the highest relative...
Ngày tải lên: 09/08/2014, 10:23
Báo cáo y học: "A meta-analysis of the efficacy of fibromyalgia treatment according to level of care" pptx
... meta -analysis of all randomised controlled trials (RCTs) of pharmacological and non-pharmacological treatments that are available in standard primary care settings and those that are administered ... pharmacological treatments and primary care • We recalculated the meta -analysis excluding these two studies and the results were the same: there were no significant differences in the efficacy of the treatments ... fibromyalgia when comparing primary care and specialised care Our meta -analysis demonstrates that there are no differences in the overall outcome of fibromyalgia regardless of the level of care in...
Ngày tải lên: 09/08/2014, 10:23