a rapprochement between developmental psychology and cognitive neuroscience

Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

Báo cáo khoa học: Hematopoietic differentiation from human ESCs as a model for developmental studies and future clinical translations Invited review following the FEBS Anniversary Prize received on 5 July 2009 at the 34th FEBS Congress in Prague docx

... Nature 460, 909–913 89 Hong H, Takahashi K, Ichisaka T, Aoi T, Kanagawa O, Nakagawa M, Okita K & Yamanaka S (2009) Suppression of induced pluripotent stem cell generation by the p53–p21 pathway ... from Leukemia and Lymphoma UK, Fanconi New advances in human hematopoiesis from human ESCs Hope UK and the Fanconi Anemia Research Fund USA, and funds for research in the field of regenerative medicine ... a CD34+ hESC-derived starting population has been considered as a potential AIDS therapy, and as a way to alleviate secondary effects produced by anti-retroviral drugs [16] Various studies have...

Ngày tải lên: 22/03/2014, 17:20

12 550 0
Báo cáo toán học: "A Bijection between Atomic Partitions and Unsplitable Partitions" ppt

Báo cáo toán học: "A Bijection between Atomic Partitions and Unsplitable Partitions" ppt

... Can and B.E Sagan, Partitions, rooks, and symmetric functions in noncommuting variables, arXiv:math.CO/1008.2950 [5] M.H Rosas and B.E Sagan, Symmetric functions in noncommuting variables, Trans ... of Science and Technology, and the National Science Foundation of China References [1] N Bergeron, C Hohlweg, M.H Rosas and M Zabrocki, Grothendieck bialgebras, partition lattices, and symmetric ... noncommutative variables, Electron J Combin 13, (2006), #R75 [2] N Bergeron, C Reutenauer, M.H Rosas and M Zabrocki, Invariants and coinvariants of the symmetric group in noncommuting variables, Canad...

Ngày tải lên: 08/08/2014, 12:23

7 356 0
Báo cáo khoa học: "Whole abdomen radiation therapy in ovarian cancers: a comparison between fixed beam and volumetric arc based intensity modulation" ppt

Báo cáo khoa học: "Whole abdomen radiation therapy in ovarian cancers: a comparison between fixed beam and volumetric arc based intensity modulation" ppt

... distributions adequate This result was achieved and RA plans resulted basically equivalent to the benchmark IMRT plans Statistically significant differences between IMRT and RA data and between low and ... smear residual tongue -and- groove and interleaf leakage effects in non planar trajectories and, more important, to allow transverse spatial modulation [20] per each degree and per each axial section ... data collection, RS performed data collection, AF performed data collection and analysis, GN performed data collection and analysis, AC performed data collection and analysis, EV performed data...

Ngày tải lên: 09/08/2014, 09:20

9 396 1
Báo cáo y học: " Treating children traumatized by war and Tsunami: A comparison between exposure therapy and meditation-relaxation in North-East Sri Lanka" pptx

Báo cáo y học: " Treating children traumatized by war and Tsunami: A comparison between exposure therapy and meditation-relaxation in North-East Sri Lanka" pptx

... Goenjian AK, Molina L, Steinberg AM, Fairbanks LA, Alvarez ML, Goenjian HA, Pynoos RS: Posttraumatic stress and depressive reactions among Nicaraguan adolescents after hurricane Mitch Am J Psychiatry ... participants and camps would have requested human and financial resources as well as transport and logistical solutions that were not available in this specific situation We had to expect that ... Goenjian AK, Steinberg AM, Najarian LM, Fairbanks LA, Tashjian M, Pynoos RS: Prospective study of posttraumatic stress, anxiety, and depressive reactions after earthquake and political violence Am...

Ngày tải lên: 11/08/2014, 17:20

11 360 0
báo cáo khoa học: " The case of Scott Ortiz: a clash between criminal justice and public health" ppsx

báo cáo khoa học: " The case of Scott Ortiz: a clash between criminal justice and public health" ppsx

... Correctional Association of New York Macias J, Japon MA, Saez C, Palacios RB, Mira JA, Garcia-Garcia JA, Merchante N, Vergara S, Lozano F, Gomez-Mateos J, Pineda JA: Increased hepatocyte fas expression ... medical, social work and legal professionals work together to understand the interface of law and health and advocate for better client outcomes Both organizations are committed to advocacy in ... trial and sentencing transcripts In addition, A. R and M.T assisted in the editing and preparation of this manuscript http://www.harmreductionjournal.com/content/3/1/21 Additional material Additional...

Ngày tải lên: 11/08/2014, 20:20

3 252 0
Báo cáo y học: "Acute kidney injury in intensive care unit patients: a comparison between the RIFLE and the Acute Kidney Injury Network classifications" potx

Báo cáo y học: "Acute kidney injury in intensive care unit patients: a comparison between the RIFLE and the Acute Kidney Injury Network classifications" potx

... mean ± standard deviation, and categorical variables are presented as the percentage of the number of cases Comparisons between RIFLE classes or AKIN stages were performed using analysis of variance ... analysis and interpretation of data JAL, ZCeS, CF and MMP were involved in drafting the manuscript and revising it critically for important intellectual content All authors gave final approval ... criteria for acute renal failure following myeloablative autologous and allogeneic haematopoietic cell transplantation Bone Marrow Transplant 2006, 38:395 [letter] Kuitunen A, Vento A, Suojaranta-Ylinen...

Ngày tải lên: 13/08/2014, 11:22

8 420 0
Báo cáo y học: " Degeneracy: a link between evolvability, robustness and complexity in biological systems" docx

Báo cáo y học: " Degeneracy: a link between evolvability, robustness and complexity in biological systems" docx

... findings and to illustrate additional ways in which degeneracy may facilitate robustness and evolvability in complex adaptive systems Our conceptual model comprises agents that are situated within an ... across a neutral network that reaches over truly unique regions of the fitness landscape Robustness and evolvability are not always compatible A positive correlation between robustness and evolvability ... Wagner asserts that, “understanding the relationship between robustness and evolvability is key to understand how living things can withstand mutations, while producing ample variation that leads...

Ngày tải lên: 13/08/2014, 16:20

17 361 0
Báo cáo y học: "A disparity between physician attitudes and practice regarding hyperglycemia in pediatric intensive care units in the United States: a survey on actual practice habits" pptx

Báo cáo y học: "A disparity between physician attitudes and practice regarding hyperglycemia in pediatric intensive care units in the United States: a survey on actual practice habits" pptx

... treatment (if applicable), and safety and efficacy of management at each center Page of Statistical analysis was conducted using a software package (SPSS for Windows, version 13.0.1, Chicago, ... a standard approach to screen for and treat hyperglycemia In addition, four other centers (13%) reported that they have a standard approach to manage hyperglycemia despite no regular approach ... Total) (% of Total) (% of Total) Centers that have a standard approach to screen for and treat hyperglycemia (7) (0) (0) (18) Centers that have a standard approach to hyperglycemia treatment only...

Ngày tải lên: 13/08/2014, 20:21

8 277 0
Báo cáo y học: "Dynamic evolution of selenocysteine utilization in bacteria: a balance between selenoprotein loss and evolution of selenocysteine from redox active cysteine residues" docx

Báo cáo y học: "Dynamic evolution of selenocysteine utilization in bacteria: a balance between selenoprotein loss and evolution of selenocysteine from redox active cysteine residues" docx

... Other bacteria and archaea Other bacteria and archaea Organization and phylogenetic analysis of components of the archaeal four-gene and bacterial five-gene operons Figure Organization and phylogenetic ... influenzae (Gammaproteobacteria/ Pasteurellales), Shewanella oneidensis (Gammaproteobacteria/Alteromonadales), and Pseudomonas aeruginosa (Gammaproteobacteria/Pseudomonadales) as relatively distant ... Methanosphaera stadtmanae C Methanococcus maripaludis U Archaea Methanocaldococcus jannaschii U Methanothermobacter thermoautotrophicus C Archaea Methanopyrus kandleri U Methanopyrus kandleri C Archaeoglobus...

Ngày tải lên: 14/08/2014, 17:22

17 362 0
olutions to the reflection equation a bijection between lattice configurations and marked shifted tableaux

olutions to the reflection equation a bijection between lattice configurations and marked shifted tableaux

... the squares of the Young diagram of λ with integers {1, 2, } such that the rows and columns are weakly increasing We say that a tableau T has shape λ Further, we call a tableau semistandard if ... model with domain wall boundaries An alternating sign matrix is a generalisation of the permutation matrix; it is a matrix of 0’s, 1’s, and -1’s such that each row and column sums to 1, and the nonzero ... this, consider a tableau T of shape λ and weight µ, n and look only at the position of i and i + 1, and set j = i + If an i and a j are in the same column, ignore them The remaining i’s and j’s lie...

Ngày tải lên: 22/12/2014, 16:55

69 331 0
SERVICE QUALITY, PERCEIVED PRICE AND CUSTOMER SATISFACTION IN HIGHER EDUCATION A comparison between Public Universities and Non-public Universities in Vietnam

SERVICE QUALITY, PERCEIVED PRICE AND CUSTOMER SATISFACTION IN HIGHER EDUCATION A comparison between Public Universities and Non-public Universities in Vietnam

... 4.3 - EFA analysis result Nacdm1 Nacdm2 Nacdm3 Nacdm4 Nacdm5 Nacdm6 Nacdm7 Nacdm8 Acadm1 Acadm2 Acadm3 Acadm4 Acadm5 Acadm6 Acadm7 Acadm8 Reptt1 Reptt2 Reptt3 Reptt4 Reptt5 Reptt6 Nacadm Acadm 685 ... students Acadm6 Academic staff communicate well in the classroom Acadm7 Academic staff has a precise method to appraise my studying performance Acadm8 Academic staff are highly educated and experience ... Reputation scale Reptt1 The institution has a professional appearance/image Reptt2 The hostel facilities and equipment are adequate and necessary Reptt3 Academic facilities are adequate and necessary...

Ngày tải lên: 01/06/2015, 20:20

75 424 0
Talk it through childrens language skill as a mediator between intrusive parenting and childrens externalizing behavior problems

Talk it through childrens language skill as a mediator between intrusive parenting and childrens externalizing behavior problems

... initial model 43 Figure Model fit and unstandardized parameter estimate for the hypothesized meditational model .46 Table Means and Standard Deviations for Demographic & Language ... which children learn and practice their language skills On one hand, parents serve as natural template and the main source of information for children's language acquisition Parents' ability to provide ... association between language skills and behavior problems is also prevalent Standard measures of children's receptive vocabulary and verbal skills were associated with children's externalizing behaviors...

Ngày tải lên: 09/09/2015, 11:31

132 140 0
Computer and video game addiction—a comparison between game users and non game users

Computer and video game addiction—a comparison between game users and non game users

... subjects and abstinent “ecstasy” patients in the caudate and putamen divided by laterality in all scans (1, 2, and 3) Table shows average V3” measures and standard deviations in the caudate putamen ... Center and Hadassah Hospital, particularly Einat Even-Sapir, Mazal Greemland, Hedva Lerman, Yodphat Krausz, and Boris Bakunin We would also like to thank David Nutt and Paul Grasby for early discussions ... game can release dopamine in vivo in the human brain comparable to the dopamine released as a result of pharmacological challenge with amphetamines (43) Behavioral paradigms, such as playing a video...

Ngày tải lên: 25/08/2016, 19:07

9 456 0
Writing a literature review in psychology and other majors

Writing a literature review in psychology and other majors

... review Drafting: Pitfalls to Avoid Unprofessional language: Avoid the appearance of cheekiness or emotional appeal Don’t plagiarize! Be extremely careful with your paraphrasing In fact, attend ... Peer-reviewed articles are a BIG deal Databases are an enormous resource for a literature review assignment PsychARTICLES, PsychINFO, ERIC, etc Abstract databases are helpful; if used, be sure to order articles ... research as specific as possible A sample paragraph with transitions Researchers have conducted studies about siblings of special needs and autistic children because this group is vulnerable...

Ngày tải lên: 01/12/2016, 22:44

14 232 0
A STUDY OF THE RELATIONSHIP BETWEEN CEO COMPENSATION AND FIRM PERFORMANCE IN THE US AIRLINE INDUSTRY 2002 2006

A STUDY OF THE RELATIONSHIP BETWEEN CEO COMPENSATION AND FIRM PERFORMANCE IN THE US AIRLINE INDUSTRY 2002 2006

... Center for Research and Security Prices, Standard and Poor’s Compustat database, and each firm’s annual reports CEO total cash compensation (salary plus bonus), stock option grants and exercise ... immediately 21 and substantially devalued The case can be made that managerial decisions to award CEOs with exorbitant salaries and bonuses while firm performance and thus stock price decreases ... a major controversy among shareholders, in the media and academia, and has experienced pressure in the legislature and economic arenas The literature suggests there are many and varied reasons...

Ngày tải lên: 11/09/2013, 11:44

132 640 0
Ways of greeting and a comparison between vietnamese and english greetings

Ways of greeting and a comparison between vietnamese and english greetings

... Whereas in many countries and in the European continent, handshaking is done when meeting and departing day in and day out and even the same assortment of acquaintances, in England as well as Great ... than men are In Afghanistan, for example, men and women have their own ways of greeting strangers A man will greet by saying manda na bashi (may you not be tired) And a women will raise her hand ... introduced to a man who is at your age, what would you say and do? a How you do? b Please to meet you. and lightly embrace him c Please to meet you. And shake his hand d Say nothing and shake hand When...

Ngày tải lên: 24/12/2013, 09:36

37 14,3K 67
Tài liệu GLOBAL PHYLOGEOGRAPHY OF A CRYPTIC COPEPOD SPECIES COMPLEX AND REPRODUCTIVE ISOLATION BETWEEN GENETICALLY PROXIMATE ‘‘POPULATIONS’’ ppt

Tài liệu GLOBAL PHYLOGEOGRAPHY OF A CRYPTIC COPEPOD SPECIES COMPLEX AND REPRODUCTIVE ISOLATION BETWEEN GENETICALLY PROXIMATE ‘‘POPULATIONS’’ ppt

... Similarly, separation appears to have occurred approximately 19 million years ago between E affinis and E americana (node A) and approximately 23 million years ago between E americana and E herdmani These ... GGTCAACAAATCATAAAGATATTGG 3Ј; Folmer et al 1994) were used to obtain sequences from COI Primer pairs 16SA2 (5Ј CCGGGT C/T TCGCTAAGGTAG) and 16SB2 (5Ј CAACATCGAGGTCGCAGTAA) were designed specifically ... BC, Canada; (27) Ishikari River, Japan; (28) Lake Baratoka, Japan; (29) Lake Ohnuma, Japan; (30) Lake Akanko, Japan; (31) Caspian Sea; (32) Gulf of Bothnia; (33) Gulf of Finland; (34) Sallvik...

Ngày tải lên: 13/02/2014, 15:20

14 491 0
Tài liệu Relationship between anthropometric variables and nutrient intake in apparently healthy male elderly individuals: A study from Pakistan docx

Tài liệu Relationship between anthropometric variables and nutrient intake in apparently healthy male elderly individuals: A study from Pakistan docx

... Pakhtunkhwa (Previously: NWFP), 25000, Pakistan Authors’ contributions IA and GP designed research; IA, and PIP conducted research and collected the data; IA and AL analyzed the data; IA wrote the manuscript; ... for a particular nutrient Statistical Analysis All anthropometric measurements were made in duplicate and the means of paired values were used in the analyses The data were statistically analyzed ... Data Age was assessed using official documents (the National Identity Card, NIC) Weight and height were measured and BMI was calculated as weight/height (kg/m ) Waist circumference (WC) and waist-to-hip...

Ngày tải lên: 14/02/2014, 06:20

9 525 0
Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt

Tài liệu Báo cáo khoa học: The crystal structure of human a-amino-b-carboxymuconatee-semialdehyde decarboxylase in complex with 1,3-dihydroxyacetonephosphate suggests a regulatory link between NAD synthesis and glycolysis ppt

... a- amino-b-carboxymuconate-e-semialdehyde decarboxylase J Am Chem Soc 129, 9278–9279 Fukuoka SI, Ishiguro K, Yanagihara K, Tanabe A, Egashira Y, Sanada H & Shibata K (2002) Identification and expression of a cDNA encoding human 6622 ... potential interest to reduce life-threatening complications of cerebral malaria, and as an important tool in validating our proposal of hACMSD as a novel drug target for the treatment of diabetes and ... tryptophan catabolism along the kynurenine pathway, and is a medically relevant enzyme in light of the important roles played by QA and PA in physiological and pathological conditions Indeed, QA is...

Ngày tải lên: 18/02/2014, 06:20

9 796 0
w