a quick start for the impatient

... of a stator, a rotor with a shaft, and coil windings The stator is a surrounding casing that remains stationary and is part of the motor housing, while the rotor is a central shaft within the ... parameters that may be provided in Freescale Semiconductor data sheets and/or specifications can and vary in different applications and actual performance may vary over time All operating parameters, ... spins as the coils are energized and de-energized This is an example of a 3-phase VR motor VARIABLE RELUCTANCE STEPPER MOTOR B A C A C A B B B 3b) C A B B 4 C 3a) C A C A 3c) Figure How the Variable...

Ngày tải lên: 28/12/2015, 19:10

... involves the transmission of payment transaction data, and associated remittance advice data, from a payee to their bank, for onforwarding (via banks and/or value-added network operators) to the payee's ... interface for service suppliers to update their own database So, there is no immediate link from the application’s database and the database of the suppliers 1.7 Organization of the research • ... payment card vouchers These mechanisms have various characteristics, such as the extent to which the parties are identified, the traceability of the transaction, and the taxability of the transaction...

Ngày tải lên: 07/04/2013, 23:51

... demonstrated the declaration and use of managed aggregate types, including ref classes, value classes, managed arrays, enum classes, and interface classes In the next section, you’ll learn about features ... halflife, int step, int max_time, int num_atoms, int seed) { array^ atoms = gcnew array(num_atoms); // Initialize the array // We cannot use a for each statement ... implementations; an abstract base class may have these Also, multiple interface classes may be inherited by a class, whereas only one noninterface class may be inherited by a managed type We want to model radioactive...

Ngày tải lên: 05/10/2013, 08:20

... a = aa = a a = ⎛ a ⎝ b⎠ b3 a × a × a = aaa = a a × b = ab a b = ( ab ) = ⎛ 1⎞ = a – -⎝ a a3 a2 a3 = a2 + = a5 ( a2 )3 = a2 × = ( a3 )2 = a6 a4 ÷ a3 = a4 – = a a + b = ( a + b ) ( a – ab ... Addition:When adding two complex numbers, the real parts and imaginary parts are added separately, the real parts added to real parts and the imaginary to imaginary parts Thus, Copyright 2004, Industrial ... a0 = a – b = ( a – b ) ( a + ab + b ) a2 – b2 = ( a + b ) ( a – b ) ( a + b ) = a + 3a b + 3ab + b a a 3 3 3 a – b = ( a – b ) + 3ab ( a – b ) a a = a 2 a + b = ( a + b ) – 3ab ( a + b ) a b...

Ngày tải lên: 15/12/2013, 03:15

... the input component on a PC is that there are a wide variety of devices available for the PC platform, as opposed to the UNIX platform This also has an important practical advantage in that a ... the lack of software that exploits the advantages of this new generation of devices Thus, the user interface for CAD programs has remained essentially the mouse/keyboard/menu paradigm The availability ... orientation tracking of a user's head and/or hand These data are then used to update the virtual world scene The tracker is sometimes also used to track the user's hand position (usually wearing a...

Ngày tải lên: 23/01/2014, 07:20

... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings together all relevant players active at European ... national, regional or local level, and to cooperate with similar fora at national level At the same time, the Platform can create input for integrating the responses to the obesity challenge into a ... multi-stakeholder approaches5 - for which the European Platform for Action on Diet, Physical Activity and Health (cf section IV.1) is a prominent example - and for action at local, regional, national...

Ngày tải lên: 14/02/2014, 13:20

... same distribution at the space-time point (x + y, t + s) as the full-space process (started at (0, 0)) at the point (y, s) Again we shall use the same random walk paths A for all the full-state ... A , which has the great advantage that the path of ρ does not depend on the paths of the other particles This is the reason why the case DA = DB is special We proved in [KSb] that on a certain ... constant whose value remains the same throughout this paper (a. s is an abbreviation of almost surely) Acknowledgement The research for this paper was started during a stay by H Kesten at the Mittag-Leffler...

Ngày tải lên: 16/02/2014, 06:20

... one species from another As far as these characters can be used, they are taken, but in addition, many characteristics of a physiological nature are added The way that the organism grows in different ... such as albuminous material Carbon in the form of carbohydrates, as sugar or starch, is most readily attacked by bacteria Inasmuch as the bacteria are plant-cells, they must imbibe[Pg 6] their ... differentiated, and that is, that practically all of them are capable of producing their characteristic chemical transformations under anaesthetic conditions, as in a saturated ether or chloroform atmosphere...

Ngày tải lên: 16/02/2014, 22:20

... of national data on current employment and the ability to link these data to higher-education databases makes it easier to gather this data today To further leverage these advances, a mechanism ... business and economic activity and the very lifeblood of global capital markets The term “accounting information” encompasses financial and nonfinancial information about the activities, performance, and ... difficult to obtain Recent advances in the coverage and accessibility of national data on employment and the ability to link these data to higher-education databases are starting to alleviate this condition...

Ngày tải lên: 18/02/2014, 01:20

... predicted and tolerable level of externalities for tobacco use have changed dramatically in the past years, and as a result, policy with respect to managing tobacco usage behavior also has changed The ... marketing, or force of law as a paradigm of choice Each paradigm has a role to play in behavior management; behavior management must be considered from the pragmatic reality created by targets and environments ... behave to accommodate the manager and the target (See, for example, the case of iodized salt discussed in P2 in the section "A Conceptual Framework for Public Health and Social Issue Behavior Management.")...

Ngày tải lên: 18/02/2014, 02:20

... stands heads and shoulders above other Groovy and Grails books available today Dave’s practical, hands-on approach will teach you the nuts and bolts of the language and framework and then lead ... assigned to a variable, passed to a method, and executed.9 Many of the enhancements Groovy has made to the standard Java libraries involved adding methods that take a closure as a parameter A ... sortedNames == ['Craig' ,'Amanda' ,'Nate' ,'Matthew' ] The first example performs a natural sort on the names The second example uses a closure to sort the names based on their size( ) The last example,...

Ngày tải lên: 18/02/2014, 05:20

... catalytic domains; black dots, protease cleavage sites (B) SDS ⁄ PAGE separation of FN3d–AP purified from conditioned media using anti-placental alkaline phosphatase (PLAP) agarose (C) SDS ⁄ PAGE ... Frisen J, Yates PA, McLaughlin T, Friedman GC, O’Leary DD & Barbacid M (1998) Ephrin -A5 (AL1 ⁄ RAGS) is essential for proper retinal axon guidance and topographic mapping in the mammalian visual system ... semipermeabilize cells for intracellular staining, cells were incubated in 4% paraformaldehyde for 30 at °C in the first instance and then stained as described above Confocal microscopy and imaging...

Ngày tải lên: 19/02/2014, 05:20

... compared to h: *P < 0.05; **P < 0.01 sion number AAG09721) are located adjacently in a head-to-head orientation, and their transcription start sites are  1.5 kb apart We therefore analyzed the ... Kitamuro T, Takahashi K, Ogawa K, Udono-Fujimori R, Takeda K, Furuyama K, Nakayama M, Sun J, Fujita H, Hida W et al (2003) Bach1 functions as a hypoxia-inducible repressor for the heme oxygenase-1 gene ... R, Takahashi K, Takeda K, Furuyama K, Kaneko K, Takahashi S, Tamai M & Shibahara S (2004) Expression of heme oxygenase-1 is repressed by interferon-gamma and induced by hypoxia in human retinal...

Ngày tải lên: 19/02/2014, 06:20

... equal, canceling the negative subgraph with a positive graph of the same absolute value (see below for an example) Therefore, only damped oscillations can be obtained in such a case Additional ... necessary for the negative graph to induce sustained oscillations We shall analyze the steady states, because the presence of steady states on the phase-space border and the irreversible steady-state ... oscillations The main result of such an analysis is that oscillations arise if the parameter k3 is the largest and the parameters k6 and k7 are the smallest in the system Oscillations in this system can...

Ngày tải lên: 19/02/2014, 16:20

... Minimize adverbs and articles Commas are a favor to the reader, not always necessary Eliminate personal pronouns When all else fails, invent a tag .A great tag works as the target of a search, and also ... communication is ubiquitous and instantaneous Those same features are also the bane of the medium Interruption and distraction can appear at any time, and anywhere The weakness of short-form communication ... social change Today, a transformation is happening Short messaging services, and the rich media applications that magnify them, are augmenting society one layer at a time Superfluous, outmoded forms...

Ngày tải lên: 19/02/2014, 21:22

... we can call this the platform And finally, at the top, there are third-party software applications (such as word processing packages) that you use in your work and play – and we can call these ... of desktop applications in a web browser SaaS applications also make use of standards for web services, and these standards enable them to easily ‘call on the services’ of other applications somewhere ... with the pay-per-use business model – have made SaaS a success The most popular and familiar example of SaaS is e-mail in a web browser, but SaaS applications are becoming increasingly sophisticated...

Ngày tải lên: 05/03/2014, 17:20

... Time Banks UK and their partners at the TimeBank campaign, and the idea has been hailed as a vital tool for rebuilding trust and social capital Community time banks are widely regarded as a neat ... trust and social capital when it has all but gone But they are still culpable It is their fault that they have clung too long to an old-fashioned idea of professionalism, and a dream that they ... depression – because they find that taking part in the time bank can mean real improvements The South London and Maudsley NHS Trust covers the same area specialising in mental health, and have watched...

Ngày tải lên: 06/03/2014, 10:20

... Modulation of metal availability for treating AD P J Crouch et al research attention as potential therapeutic targets Plaques and NFTs, however, cannot be regarded as ‘upstream’ causative factors ... stress, a loss of regulation of Ab production, and an increase in tau hyperphosphorylation Furthermore, an increase in extracellular metals can catalyse Ab oligomerization and aggregation, and the amyloid ... the amyloid plaques in AD brain [42,43], global AD research focused on this peptide as a causative agent in the disease The 39–43 amino acid cleavage product of the Ab A4 precursor protein (APP)...

Ngày tải lên: 07/03/2014, 10:20

... Primers with the following sequences were synthesized by Proligo (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox ... acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on the presence of ascorbic acid in lower ... l-gulono-1,4-lactone [17] as substrates d-Arabinono-1,4-lactone is a natural substrate in the pathway to d-erythroascorbic acid [14,18] Like yeasts, a protozoan parasite Trypanosoma brucei possesses a d-arabinono-1,4-lactone...

Ngày tải lên: 07/03/2014, 12:20

Ngày tải lên: 07/03/2014, 15:20