a quantum chemistry and computational kinetics approach

báo cáo hóa học: " A neural tracking and motor control approach to improve rehabilitation of upper limb movements" potx

báo cáo hóa học: " A neural tracking and motor control approach to improve rehabilitation of upper limb movements" potx

... paper, the markerless motion estimation method and the neural controller have been presented The approach has been tested on real data and comparative results between the real, the estimated and ... augmented with a neural prosthesis: A cross-over study Canadian Journal of Physiology and Pharmacology 2004, 82:749-756 Furuse N, Watanabe T, Ohba S, Futami R, Hoshimiya N, Handa Y: Control-Command Detection ... trajectory parameters extracted by the NS algorithm are used to drive a neural controller which activates a biomechanical model of a simulated human arm and controls the FES To this purpose, and...

Ngày tải lên: 19/06/2014, 10:20

12 559 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

... ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 Type-specific PCR upper primer TGT GCT GCC ATA TCT ACT TCA GAA ACT AC Type-specific ... crystalline phase of superparamagnetic nanoparticles Table Hybridization probes and type-specific PCR primers Sequence Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT ... hybridization assay method only require extraction of DNA of the samples and simple incubation as well as magnetic separation, which has a good acceptability for any average lab assistant Table Comparison...

Ngày tải lên: 21/06/2014, 01:20

9 469 0
Báo cáo lâm nghiệp: "The effects of lifting on mobilisation and new assimilation of C and N during regrowth of transplanted Corsican pine seedlings. A dual 13C and 15N labelling approach" docx

Báo cáo lâm nghiệp: "The effects of lifting on mobilisation and new assimilation of C and N during regrowth of transplanted Corsican pine seedlings. A dual 13C and 15N labelling approach" docx

... effects of decreased water and N entry, through decreased stomatal conductance and increased allocation of N As a consequence, C assimilation, carbohydrate concentration, and N availability for new ... growth after lifting, remain to elucidate Lifting and transplanting cause fine root damage This stress can negatively impact C, N, and water uptake and then alter root regrowth The major goal of ... S.J., Hickie D.F., Noland T.L., Amino acid, carbohydrate, glutathione, mineral nutrient and water potential changes in non stressed Picea mariana seedlings after transplanting, Scand J For Res 14...

Ngày tải lên: 08/08/2014, 01:22

11 400 0
Trends in digital library research  a knowledge mapping and ontology engineering approach

Trends in digital library research a knowledge mapping and ontology engineering approach

... Database(General)(1210), Image Database(29),Video Database(14),Web Databases(13),Music Database(8) Collection Management(50), Resources Management(46),Collection Evaluation(2), Information Evaluation(2) ... in China and at international level by using co-word analysis, social network analysis and mapping of knowledge domains on a sample of total 6068 and 1250 papers published between 1994 and 2010 ... among digital library researchers and practitioners internationally (Chen, H et al, 2005) Nagatsuka and Kando (2006) discussed digital library research and development in the Asia Pacific region...

Ngày tải lên: 12/08/2015, 23:42

246 295 0
Diversification and diffusion   a social networks and neo institutional approach

Diversification and diffusion a social networks and neo institutional approach

... unearth and correct the potential and flaw of this thesis Great thanks to the administrative and academic community of NUS I am also grateful to David Strang for sharing the SAS macro program ... strategic characteristics because the decision makers in adopting organizations view similar organizations as more relevant and easier to learn from (Ahuja & Katila, 2001; Davis & Greve, 1997; Haunschild ... education and professional and trade associations (DiMaggio & Powell, 1983) The former confers legitimacy to an occupation in a form of organizational norms among professional managers The latter,...

Ngày tải lên: 04/10/2015, 17:04

103 812 0
Tài liệu Báo cáo khoa học: Molecular determinants of ligand specificity in family 11 carbohydrate binding modules – an NMR, X-ray crystallography and computational chemistry approach doc

Tài liệu Báo cáo khoa học: Molecular determinants of ligand specificity in family 11 carbohydrate binding modules – an NMR, X-ray crystallography and computational chemistry approach doc

... interact mainly by hydrogen bonds, with a central area of CtCBM11 containing the amino acids Asp99, Arg126, Asp128 and Asp146 and, in the case of the larger ligands, with Asp51 It is important ... cellooligosaccharides by a family 17 carbohydrate-binding module: An X-ray crystallographic, thermodynamic and mutagenic study J Mol Biol 314, 797–806 Carvalho AL, Goyal A, Prates JAM, Bolam DN, ... important interactions that occur between all the analyzed carbohydrate ligands, including the a and b isomers, and the neighbouring amino acids of the CtCMB11 cleft These average values were obtained...

Ngày tải lên: 18/02/2014, 17:20

12 688 0
Báo cáo y học: "A comprehensive transcript index of the human genome generated using microarrays and computational approaches" pdf

Báo cáo y học: "A comprehensive transcript index of the human genome generated using microarrays and computational approaches" pdf

... SRF and its accessory proteins EMBO J 1992, 11:4631-4640 Kawamoto T, Makino K, Niwa H, Sugiyama H, Kimura S, Amemura M, Nakata A, Kakunaga T: Identification of the human beta-actin enhancer and ... Rosetta Gene Expression Laboratory for sample preparation and hybridization, S Dow for reagent and primer handling, and E Coffey and the Array Production Team for array synthesis We also thank ... genomic tiling arrays Additional data file contains a comparison of EVG predictions with RefSeq sequences (March 2004) Also available on our website [19] are: ratio data and body atlas data along with...

Ngày tải lên: 14/08/2014, 14:21

17 262 0
A COMPUTATIONAL STUDY OF FREE RADICALS IN CHEMISTRY AND BIOLOGY

A COMPUTATIONAL STUDY OF FREE RADICALS IN CHEMISTRY AND BIOLOGY

... that NO• activates an enzyme guanylyl cyclase and activates smooth muscle relaxation [5, 6] Ignarro made two key observations – that NO• has an effect of relaxing an artery [7] and this same gas ... empirical parameters A similar approach has also been taken to obtain analytical forms of gradient corrected correlation functionals, but their explicit forms are complicated and not easily understood ... N is a normalization constant; x, y, and z are spherical coordinates; n, l, m are integral exponents at Cartesian coordinates, and α is called the “exponent” here GTFs allow fast calculation...

Ngày tải lên: 11/09/2015, 21:28

219 313 0
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx

... Asp140, Asp142, Glu144 and Asp215 were mutated individually to asparagine and alanine, Tyr10 and Tyr214 were replaced by Phe, and Ser93 was replaced by alanine All clones expressing ChiB variants ... 22 pKa calculations pKa values for Asp140, Asp142, Glu144 and Asp215 were calculated in several ChiB mutants as described in Materials and methods (Table 3) Calculations were primarily based ... 8.0 range, and a marked increase in Km at alkaline pH (Table 2, Fig 3) The D215N and D140N mutants displayed an acidic shift in the pH-activity profiles, whereas the Y214F and the E144Q mutants...

Ngày tải lên: 07/03/2014, 14:20

10 652 0
Báo cáo khoa học: "Transparent combination of rule-based and data-driven approaches in a speech understanding architecture" pot

Báo cáo khoa học: "Transparent combination of rule-based and data-driven approaches in a speech understanding architecture" pot

... these features are defined by hand-coded rules, and some by surface utterance characteristics like word Ngrams The available data is used to train statistics which evaluate each feature's reliability ... constrains and lack of access to users made it difficult to better than this We transcribed and annotated the data using a simple Java-based tool, randomly selecting 75% of it for use in training and ... grammar contains 129 rules and 258 lexical items, and the compiled recogniser achieves a word error rate of approximately 19% on unseen in-domain test data using our normal software and hardware...

Ngày tải lên: 08/03/2014, 21:20

8 461 0
Computational Chemistry and Molecular Modeling ppt

Computational Chemistry and Molecular Modeling ppt

... Computational Chemistry and Molecular Modeling K I Ramachandran · G Deepa · K Namboori Computational Chemistry and Molecular Modeling Principles and Applications 123 Dr K I Ramachandran Dr ... Beloved Sadguru and Divine Mother Sri MATA AMRITANANDAMAYI DEVI Preface Computational chemistry and molecular modeling is a fast emerging area which is used for the modeling and simulation of small ... G Deepa K Namboori Amrita Vishwa Vidyapeetham University Computational Engineering and Networking 641 105 Ettimadai Coimbatore India ki_ram@ettimadai.amrita.edu os_deepa@ettimadai.amrita.edu...

Ngày tải lên: 15/03/2014, 18:20

405 452 0
Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

Báo cáo khoa học: The use of recombinant protein and RNA interference approaches to study the reproductive functions of a gonad-stimulating hormone from the shrimp Metapenaeus ensis ppt

... primers (forward, 5¢-TAATACGACTCACTATAGGTACTATG TATCGCATGCCAAT-3¢; reverse, 5¢-TAATACGACTC ACTATAGGTACTTTAAAGTCCCGGGTTGA-3¢) For PCR, the reaction mix consisted of · Taq buffer containing 1.5 mm MgCl2, ... reverse, 5¢-AGGAGATCTAAGCTTACCA CGCTCCACCAGGG-3¢) that contained restriction sites EcoRI and BamHI, respectively The PCR product was first digested with EcoRI and HindIII, and was then ligated into ... the hepatopancreas and ovary of the shrimp were dissected for total RNA preparation, and the hemolymph samples were collected for SDS ⁄ PAGE and western blot analysis dial membrane of a periopod...

Ngày tải lên: 16/03/2014, 05:20

11 546 0
APPROACHING AWE, A MORAL, SPIRITUAL, AND AESTHETIC EMOTION docx

APPROACHING AWE, A MORAL, SPIRITUAL, AND AESTHETIC EMOTION docx

... Man and Animals (1872), Darwin analysed admiration, a close relative of awe Darwin defined admiration as a mixture of surprise, pleasure, and approval, as well as astonishment His characterisation ... Denotes that the appraisal is usually made in this case ? Denotes that the appraisal is sometimes made in this case (and if it is made, it adds a flavour) a Denotes states that are related to awe, ... between awe and gratitude, admiration, elevation, surprise, fear, and perhaps even love Darwin cited certain facial actions that may be associated with awerelated states Perhaps more interesting are...

Ngày tải lên: 16/03/2014, 18:20

18 441 0
Báo cáo khoa học: "a system for tutoring and computational linguistics experimentation" pptx

Báo cáo khoa học: "a system for tutoring and computational linguistics experimentation" pptx

... the data we collected to identify student paraphrases of correct answers The annotated data will be used to evaluate the accuracy of existing paraphrasing and textual entailment approaches and ... Patricia Albacete 2006 A natural language tutorial dialogue system for physics In Proceedings of the 19th International FLAIRS conference Charles B Callaway, Myroslava Dzikovska, Elaine Farrow, Manuel ... Butler, and Colin Matheson 2008b Diagnosing natural language answers to support adaptive tutoring In Proceedings 21st International FLAIRS Conference, Coconut Grove, Florida, May Amruta Purandare and...

Ngày tải lên: 17/03/2014, 00:20

6 493 0
Báo cáo khoa học: "Paragraph-, word-, and coherence-based approaches to sentence ranking: A comparison of algorithm and human performance" ppt

Báo cáo khoa học: "Paragraph-, word-, and coherence-based approaches to sentence ranking: A comparison of algorithm and human performance" ppt

... paragraph as important, and the other sentences as not important We included this approach merely as a simple baseline 2.2 Word-based approaches Word-based approaches to summarization are based ... MSWord summarizer was to have a more useful baseline for scalable sentence rankings than the paragraph-based approach provides NoParagraph mean rank correlation coefficient WithParagraph 0.6 0.5 ... compare human rankings to the paragraph-based baseline approach, we calculated point biserial correlations (cf Bortz (1999)) We obtained significant correlations between paragraph-based rankings...

Ngày tải lên: 17/03/2014, 06:20

8 415 0
Báo cáo khoa học: A novel transmembrane topology of presenilin based on reconciling experimental and computational evidence pptx

Báo cáo khoa học: A novel transmembrane topology of presenilin based on reconciling experimental and computational evidence pptx

... Evidence for a six-transmembrane domain structure of presenilin J Biol Chem 272, 12047–12051 Nakai T, Yamasaki A, Sakaguchi M, Kosaka K, Mihara K, Amaya Y & Miura S (1999) Membrane topology of Alzheimer’s ... (1998) Additional evidence for an eight-transmembrane-domain topology for Caenorhabditis elegans and human presenilins Proc Natl Acad Sci USA 95, 7109–7114 Lehmann S, Chiesa R & Harris DA (1997) Evidence ... & Haass C (2004) The presenilin C-terminus is required for ER-retention, nicastrin-binding and gamma-secretase activity Embo J 23, 4738–4748 Tomita T, Takikawa R, Koyama A, Morohashi Y, Takasugi...

Ngày tải lên: 23/03/2014, 13:20

7 458 0
Báo cáo khoa học: "A Linguistic and Computational Analysis of the German "Third Construction"*" potx

Báo cáo khoa học: "A Linguistic and Computational Analysis of the German "Third Construction"*" potx

... Na Va V21"1 whenever and as soon as this is possible Using a BEPDA rather than an EPDA has two advantages: first, the data-driven bottom-up automaton represents a more intuitive model of human ... either an input is read and pushed onto a new stack on top of the stack of stacks, or a fixed number of stacks below and above a designated stack on the stack of stacks is removed and a new symbol ... lacking a nominal complement (namely Va's) The reason why Na and V3 can't be unwrapped around V~ is that Va does not subcategorize for a clausal complement We then unwrap N3 around V~ and get...

Ngày tải lên: 23/03/2014, 20:20

3 355 0
NEW TRENDS IN QUANTUM SYSTEMS IN CHEMISTRY AND PHYSICS ppt

NEW TRENDS IN QUANTUM SYSTEMS IN CHEMISTRY AND PHYSICS ppt

... Physics A series reporting advances in theoretical molecular and material sciences, including theoretical, mathematical and computational chemistry, physical chemistry and chemical physics Aim and ... (properties and spectra); - Reactive collisions and chemical reactions, computational chemistry and physics; and - Condensed matter (clusters and crystals, surfaces and interfaces) Density matrices and ... especially Alexandre Kuleff, Alexis Markovits, Cyril Martinsky and, last but not least, Ms Yvette Masseguin, technical manager of the workshop Jean Maruani and Christian Minot Paris, 2000 Part...

Ngày tải lên: 28/03/2014, 10:20

324 355 0
Addressing Chronic Disease through Community Health Workers: A POLICY AND SYSTEMS-LEVEL APPROACH doc

Addressing Chronic Disease through Community Health Workers: A POLICY AND SYSTEMS-LEVEL APPROACH doc

... education and disease and case management (for heart disease and stroke, diabetes, prenatal care, immunizations, breast and cervical cancer, diabetes, and asthma) but also the promotion of change ... health insurance; enrollment and referral to appropriate health care agencies; and mater­ nal health and prenatal care Division for Diabetes Translation (DDT) A number of state and territorial ... burden of diabetes is disproportionately borne by American Indians and Alaska Natives, African Americans, Hispanic or Latino Americans, and Asians/Pacific Islanders The devel­ opment of diabetes is...

Ngày tải lên: 28/03/2014, 21:20

20 260 0
w