a push notification helper library
Báo cáo hóa học: " Neutralizing human monoclonal antibody against H5N1 influenza HA selected from a Fab-phage display library" pptx
Ngày tải lên :
20/06/2014, 01:20
... Ungchusak K, Auewarakul P, Dowell SF, Kitphati R, Auwanit W, Puthavathana P, Uiprasertkul M, Boonnak K, Pittayawonganon C, Cox NJ, et al.: Probable person-to-person transmission of avian influenza A ... Guan Y, Wang J, Smith GJ, Xu KM, Duan L, Rahardjo AP, Puthavathana P, Buranathai C, Nguyen TD, et al.: Genesis of a highly pathogenic and potentially pandemic H5N1 influenza virus in eastern Asia ... antibodies used in the neutralization assay was lowered from A B 120 % Control 100 80 60 40 20 N o VN Ab 04 H A H A H A H A H A H A H A H A H 10 A H 11 A H 12 A H 14 A H 16 A H 17 A VL 18 P VL P VL P...
- 10
- 418
- 0
báo cáo khoa học: " Screening and Identification of a Renal Carcinoma Specific Peptide from a Phage Display Peptide Library" pot
Ngày tải lên :
10/08/2014, 10:21
... cG250 and low dose subcutaneous IL-2 in patients with advanced renal cell carcinoma Cancer Immun, 2007, 7: 13 14 Xu C, Lo A, Yammanuru A, Tallarico AS, Brady K, Murakami A, Barteneva N, Zhu Q, Marasco ... Screening and Identification of a Renal Carcinoma Specific Peptide from a Phage Display Peptide Library Xiangan Tu1*§, Jintao Zhuang1*, Wenwei Wang1, Liang Zhao1, Liangyun Zhao1, Jiquan Zhao1, Chunhua ... potential for use in early diagnosis and targeted therapy of RCC Materials Renal carcinoma line A4 98 and a normal renal cell line HK-2 were obtained from Medical Academy of China (Beijing, PR China)...
- 28
- 266
- 0
báo cáo khoa học: " Identification of an extensive gene cluster among a family of PPOs in Trifolium pratense L. (red clover) using a large insert BAC library" ppsx
Ngày tải lên :
12/08/2014, 03:20
... TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCAATAGACAATTT (701) TAACCCTGCTACTAATCCAAGTGCAGAAGAACAAATCAAAATCAACCTTACTTGGATGCATAAACAAATGATCTCCAACAGCAAGACCAATAGACAATTT ... http://www.biomedcentral.com/1471-2229/9/94 100 (1) ATGATACTAACCAAAATAGCCCTAAAGAACAAGAACAAAAAGCATCACCTAGAAGAAATGTTCTAATAGGTCTAGGAGGACTTTATGGTGCTACCACTTT (1) ATGATACTAACCAAAATAGTCCTAAAGAACAAGAACAAAAATCATCACCAAGAAGAAATGTTCTAATAGGTCTAGGAGGACTTTATGGTGCTACCACTTT ... CCATTTTTACAAATCCAAATTCTTCCCTTTATGACCCTAGAAGAAATCCCTCACATCAACCACCAACAATCGTTGACCTAAACTATAACAAAGCTAATGA (601) CCATTTTTACAAATCCAAATTCTTCCCTTTATGACCCTAGAAGAAATCCCTCACATCAACCACCAACAATCGTTGACCTAAACTATAACAAAGCTAATGA...
- 11
- 275
- 0
báo cáo khoa học: " An analysis of expressed sequence tags of developing castor endosperm using a full-length cDNA library" ppsx
Ngày tải lên :
12/08/2014, 05:20
... Narusaka M, Kamiya A, Ishida J, Satou M, Sakurai T, Nakajima M, Enju A, Akiyama K, Oono Y, Muramatsu M, Hayashizaki Y, Kawai J, Carninci P, Itoh M, Ishii Y, Arakawa T, Shibata K, Shinagawa A, ... lipid metabolism such as acyl carrier protein (ACP), stearoylACP desaturase, and malonyl-CoA:ACP transacylase Interestingly, as listed in Table 1, we identified a class-3 triacylglycerol lipase (cn82) ... the FAH12 gene, the following pair of gene specific primers were used: 5'ATGGGAGGTGGTGGTCGCAT-3' and 5'-TTAATACTTGTTCCGGTACC-3' The primers 5'-ATGGCTGAGCATCAACAATCAC-3' and 5'-TCAGCCCTGTCCTTCATCTC-3'...
- 9
- 286
- 0
A Push-pull based Application Multicast Layer for P2P live video streaming
Ngày tải lên :
25/03/2015, 09:37
... exchange data with each other Therefore, we can reduce the time gap between arrival times of pushing data and pulling data As a result, our mechanism can reduce buffering time at each node Another ... [CdSLMM11] Ana Paula Couto da Silva, Emilio Leonardi, Marco Mellia, and Michela Meo, Chunk distribution in mesh-based large-scale p2p streaming systems: A fluid approach, IEEE Trans Parallel Distrib ... node failure In the case both parent and grandparent nodes leave at the same time, a node can ask an ancestor node to repair the tree since it has the list of all ancestor nodes A node that does...
- 54
- 318
- 0
Tìm hiểu về Push Notification xây dựng ứng dụng nhắc lịch thi cho sinh viên Thăng Long trên nền tảng Android.PDF
Ngày tải lên :
05/05/2015, 14:59
... (Analysis class diagram) ! User Giao then cal dat SessionManager AlarmManager So trinh hr (Sequence diagram) a A r -\ , r -A _.) : User : Gan dien rai dat (7-4-.\, i : Cncsinnbtananer alialareianaga ... sau: GO - a DIE OCII Tilt API Access Omen, to Drat Pea Sane Olt':: Ina or API moats Le rig a ram OALTI lace Ae1kcy Sara TWA Authorized API Access API beasts RUPOIN 7; • vv y CPICAS tot JIzta- ... cho Android de phan biet san pham cua Ito yen san pham cua nhung ngulai khac Dieu don gian lam cho mo hinh phat trien Android rat hap clan va do khai day sy quan tam cua nhieu nha cung cap Nhung...
- 80
- 2.9K
- 0
Tiểu luận môn điện toán đám mây PUSH NOTIFICATION SYSTEM
Ngày tải lên :
19/05/2015, 21:14
... payload, số bit, byte khác Máy chủ nên tạo payload dạng Json Một payload đơn giản sau: { "APS": { "alert": "Xin chào!", "sound": "default" } } Kích thước payload không vượt 256 byte 2.2 Push notification ... đ a vào hang đợi “Api queue in” khu vực Web admin có woker “Lookup api queue to DB” làm nhiệm vụ lấy data từ “Api quque in” lưu vào DB • Từ trang web admin, có yêu cầu vào thời điểm A, push cho ... Diễm An CH1301075 17 gender String version String username String os_version String create_on Date update_on Date Bảng DeviceReport Tên cột Kiểu liệu id Long create_on Date total Long fail Long pushSchedule...
- 19
- 535
- 0
Luận văn tìm hiểu về push notification xây dựng ứng dụng nhắc lịch thi cho sinh viên thăng long trên nền tảng android
Ngày tải lên :
03/07/2016, 22:11
... cho Android de phan biet san pham cua Ito yen san pham cua nhung ngulai khac Dieu don gian lam cho mo hinh phat trien Android rat hap clan va do khai day sy quan tam cua nhieu nha cung cap Nhung ... sau: GO - a DIE OCII Tilt API Access Omen, to Drat Pea Sane Olt':: Ina or API moats Le rig a ram OALTI lace Ae1kcy Sara TWA Authorized API Access API beasts RUPOIN 7; • vv y CPICAS tot JIzta- ... trang thai ung dung khong thay doi Diem ma rang !Chang có Thief ke UML Sa M lop phan tich (Analysis class diagram) Database a A User K\ y > Flat dans xuat -
- 86
- 784
- 2
MicrowaveAssisted Fluorous Synthesis of a 1,4Benzodiazepine2,5dione Library
Ngày tải lên :
26/08/2016, 11:22
... Hospital Supporting Information Available LC/MS and HR-MS and 1H and 13C NMR data for selected intermediates and final products This material is available free of charge via the Internet at http://pubs.acs.org ... Acknowledgment This work was supported by Shandong University, National Cancer Institute (P30CA027165), the American Lebanese Syrian Associated Charities (ALSAC), and St Jude Children’s Research ... di-tert-butyl dicarbonate (3.0 mmol) was added The mixture was stirred at room temperature for h until TLC showed the disappearance of anthranilic acid The reaction mixture was added mL water and distilled...
- 11
- 376
- 0
How To Start A Friends Of The Library Group
Ngày tải lên :
05/12/2016, 17:38
... the library and needs people who really care about their library If a Library staff person or a Library Board Trustee are spearheading the formation of a Friends group, they can make the ... locations, advertise a meeting to attract interested people who are regular library users, who care about the library and who might have some time to give to support the library You may also want ... http://www.law-nonprofit.org/25-6nfp.htm Register for Charitable Status immediately following adoption of the Constitution and By Laws Be aware that if your library already has charitable status,...
- 51
- 371
- 0
Tài liệu Appendix A: Library Database Case Study pdf
Ngày tải lên :
11/12/2013, 14:15
... What percentage of all loans eventually becomes overdue? What is the average length of a loan? What are the library s peak hours for loans? Appendix A: Library Database Case Study Library Database ... Appendix A: Library Database Case Study Loan Information The reservation, loan, and loanhist tables contain the library s loan information The reservation table tracks current reservations for each ... the card’s expiration date Ideally, cards that have expired or are about to expire will be highlighted Appendix A: Library Database Case Study The screen also displays information about a member’s...
- 6
- 571
- 0
Tài liệu Báo cáo khoa học: "Learning to Compose Effective Strategies from a Library of Dialogue Components" doc
Ngày tải lên :
20/02/2014, 12:20
... Q-function for a certain action taken in a certain state describes the total reward expected between taking that action and the end of the dialogue For each state-action pair (s, a) , we calculated this ... policy for each evaluation measure separately (by only using the rewards given for that particular measure), and a policy based on a combination (sum) of the rewards for all evaluation measures We ... base feature set was generated automatically, but quite a lot of features were manually tuned or added to cope with certain common dialogue situations The overall classification accuracy, measured...
- 8
- 418
- 0
Báo cáo khoa học: Effects of a novel arginine methyltransferase inhibitor on T-helper cell cytokine production pot
Ngày tải lên :
06/03/2014, 11:20
... [pii] Purandare AV, Chen Z, Huynh T, Pang S, Geng J, Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayaraman L (2008) Pyrazole inhibitors of coactivator associated arginine methyltransferase (CARM1) ... (M.G.F.) K .A. M is the recipient of an Arthritis Investigator Award and the Donald and Delia Baxter Foundation Young Career Scientist Award References Lin WJ, Gary JD, Yang MC, Clarke S & Herschman HR ... effective methyltransferase inhibitors Only AMI-1 and AMI-6 demonstrated selectivity for the PRMTs, although AMI-6 was minimally active against a cellular PRMT substrate [8] Computational modeling...
- 13
- 646
- 0
A Library Primer by John Cotton Dana ppt
Ngày tải lên :
07/03/2014, 16:20
... sizes and many thicknesses Select what suits you See Library Bureau catalog Catalog case See Library Bureau catalog For a very small library a few japanned tin trays will serve But your catalog ... rules; Library Bureau, 1899, $1.25 These are called the Library school rules Catalog of A L A library; 5000v for a popular library, selected by the American Library Association, and shown at the ... down as the first rule of library management; and for the second, let it be said that librarian and assistants are to treat boy and girl, man and woman, ignorant and learned, courteous and rude,...
- 164
- 274
- 0
Báo cáo khoa học: Identification of calreticulin as a ligand of GABARAP by phage display screening of a peptide library pdf
Ngày tải lên :
16/03/2014, 05:20
... folded GABARAP [22] The addition of CRT to GABARAP resulted in the disappearance of GABARAP resonances, a clear indication of binding (Fig 3B) Only weak amide signals for a Gln ⁄ Asn side chain and ... is a high affinity ligand for GABARAP peptides presumably interacted with GABARAP with similar affinities This considerable sequence variability for GABARAP binding peptides suggests that GABARAP ... response Rmax was fitted as a separate parameter for each binding sensorgram The dissociation constant was obtained as Kd ¼ koff ⁄ kon NMR All NMR spectra were recorded at 25 °C on a Varian (Darmstadt,...
- 13
- 560
- 0
The Smashing editors choice: a smashing library treat
Ngày tải lên :
16/03/2014, 10:27
... international audience, and we have to make sure that all characters are supported and that the typeface works in languages less common than English and Spanish Each language has a particular critical ... characters as images and rotates and mirrors letters As a result, a lowercase two-story a with a weak tail might appear the same to a dyslexic person as an italic “e.” In addition, most characters ... from a display typeface Because headings are a part of the main text, they are best set with a variation of the primary typeface (small caps, for instance) As stated, this is more of a safe bet...
- 167
- 396
- 0
Nicolai josutis the c++ standard library a tutorial and reference
Ngày tải lên :
19/03/2014, 14:11
... Detail 14.4 Facets in Detail 15 Allocators 15.1 Using Allocators as an Application Programmer 15.2 Using Allocators as a Library Programmer 15.3 The Default Allocator 15.4 A User-Defined Allocator ... template class allocator; } The default allocator is used as the default value everywhere an allocator can be used as an argument It does the usual calls for memory allocation and deallocation; ... designations appear in this book and Addison Wesley Longman Inc., was aware of a trademark claim, the designations have been printed in initial caps or all caps The authors and publisher have taken...
- 642
- 408
- 1
WHO Library Cataloguing-in-Publication Data: Gender and tobacco control: a policy brief ppt
Ngày tải lên :
22/03/2014, 11:20
... consideration in its market research for almost a century This has resulted in “male” brands and “female” brands, supported by tailored marketing campaigns and imagery that are also often aimed at ... messages may have a particular impact on girls and women, as global illiteracy rates are higher for women than men Implement large, visible, and regularly changing health warnings and messages ... assistance We also would like to thank Ms Carla Salas-Rojas of the Department of Gender, Women & Health and Dr Luminita Sanda, Ms Smita Trivedi and Ms Gemma Vestal of the Tobacco Free Inititiative...
- 20
- 560
- 0
Variation in Helper Type Affects Group Stability and Reproductive Decisions in a Cooperative Breeder doc
Ngày tải lên :
28/03/2014, 16:20
... towards a mirror image was assessed three times and averaged (400 l tank) (b) Helping behaviour was assessed as the average of two tests digging sand away from two pot halves when living as a ... observations, focal adult males were generally more aggressive towards their mates and subordinates than the focal females were towards their mates and subordinates (Table 1), and aggression towards ... 10-min observation for each focal (‘digging alone’) In the evening of the same day, a large male and female was added, who accepted the focal individual as a subordinate in each case successfully During...
- 13
- 303
- 0
Báo cáo khoa học: Selection of a CXCR4 antagonist from a human heavy chain CDR3-derived phage library doc
Ngày tải lên :
28/03/2014, 22:20
... Biochim Biophys Acta 1780, 914–920 Tamamura H, Imai M, Ishihara T, Masuda M, Funakoshi H, Oyake H, Murakami T, Arakaki R, Nakashima H, Otaka A et al (1998) Pharmacophore identification of a chemokine ... Kinetic data analysis was performed using biaevaluation 4.1 software employing a two-state reaction model in agreement with the presence of linked reactions Analysis of amino acid sequences Ala scanning ... frequency acted as an antagonist (IC50 = 23 lm) and displayed an affinity of 5.6 lm A discrepancy in the potency of clone in phage format (nanomolar range activity) and in peptide format (micromolar range...
- 12
- 299
- 0