a promising contender for the researcher
The New Community Rules: Marketing on the Social Web docx
... public? The traditional approach would be to sit back and wait for the wave of complaints to stop Today, with the ease of spreading information, that is not the ideal approach Instead, joining in the ... dissatisfaction and possibly use the personal web space as a grounds to tear apart the reputation of the company On the other hand, satisfied customers have also launched web pages and uploaded ... Introduction to Social Media Portals Fortunately, there are already a number of portals available online that can empower you, as a marketer, to start spreading your message Innovation, too, can bring success,...
- 368
- 956
- 1
A little but often - how to increase your vocabulary
... how to make intelligent guesses about words you have not seen or used before This is necessary because you cannot "learn" all the words as there are simple too many of them: only this week the millionth ... Look for common words The first step is to understand this idea: that the words you need to notice and pay attention to are the words you probably ignore as being too simple to learn You recognise ... will add, however, that you need to practise regularly and intelligently for this work By this I mean you want to learn to notice patterns in different word families: to give you one example, all...
- 3
- 603
- 4
TEMPORAL VARIATIONS OF POLLUTANT LOADS DURING STORM EVENTS IN A SMALL RIVER BASIN
... midstream area of Uji River and around the junction of Uji River and Niyodo River There are many pulp factories around the downstream area of Saina River, and the wastewater from the factories ... Takaaki Doi and Mr Daisuke Hagiwara for their support for this work We are also grateful to the financial support by Charitable trust wastewater management research promotion fund REFERENCES Ana Deletic ... B) Analytical methods are numbered in Standard Methods for the examination of water and wastewater - 185 - Journal of Water and Environment Technology, Vol.3, No.2, 2005 the laboratory in accordance...
- 8
- 374
- 0
Tài liệu ANSYS Mechanical- A Powerful Nonlinear Simulation Tool pdf
... Stamping (ANSYS LS-DYNA) and springback analysis (ANSYS Mechanical) Figure Nonlinear collapse study of a beverage can Common Features ANSYS Mechanical data input can be parametric, allowing for parametric ... also made available Anand’s model uses an internal scalar variable called the deformation resistance to represent the isotropic resistance to the inelastic flow of the material, and is thus able ... solver such as the AMG (Algebraic Multi Grid) equation is a particular strength of the ANSYS Mechanical program Moreover, the calculation can take advantage of parallel processing in a shared memory...
- 39
- 591
- 3
Tài liệu HOW TO ORGANIZE AND RUN A SMALL BUSINESS ppt
... government loan Whether applying to a lender for a regular SBA loan, or directly to SBA for prequalification, all applications are evaluated on the repayment ability of the business itself, the management ... maximum available in venture capital funds for a business Venture capital firms are located nationwide, and a directory is available for $25 through the National Association of Venture Capital, ... value of the net assets at the most current balance sheet date Fair Market Value of Net Assets The fair market value of the net tangible assets of the company may be based on independent appraisal...
- 137
- 665
- 1
Tài liệu BRITISH COLUMBIA STARTING A SMALL BUSINESS OCTOBER 2011 EDITION pdf
... services to other companies or organizations page 13 you may consider joining Industry Canada’s Canadian Company Capabilities Database to ensure buyers in Canada and around the world know about your ... west coast of the Americas Today, Canada’s Pacific Gateway is a world-class transportation network Its integrated, seamless supply chain includes airports, seaports, railways, roadways and border ... society also offers skills training for women in such topics as marketing, financial management and strategic thinking GENER AL INFORMATION Canada’s Pacific Gateway www.th.gov.bc.ca/PacificGateway/index.htm...
- 28
- 532
- 0
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf
... within the tail that are the critical targets for the cleavage Because the transfected Flag-TD vector (s-DAPK-1Dtail) is similar to the in vivo cleaved form of Flag–s-DAPK-1 in size, five tail mutants ... band, and s-DAPK-1N29 8A ⁄ L29 9A (TM2) showed a weakened cleavage band (Fig 3B) These data suggest that the first two amino acids of the tail are critical for proteolytic susceptibility, and that the ... third and fourth amino acids are involved in the regulation of this cleavage This also further fine-maps the site of cleavage, and indicates that the tail deletion (s-DAPK-1Dtail) may be used as a...
- 11
- 659
- 0
Tài liệu Báo cáo khoa học: "a Computer-Aided Summarisation Tool" docx
... on Language Resources and Evaluation, pages 1187 — 1191, Athens, Greece, 31 May —2 June Chris D Paice 1981 The automatic generation of literature abstracts: an approach based on the identification ... Donaway, Kevin W Drummey, and Laura A Mather 2000 A comparison of rankings produced by summarization evaluation measures In Proceedings of NAACL-ANLP 2000 Workshop on Text Summarisation, pages ... the extract into an abstract As not all sentences identified automatically are worth including in a summary, the user has the option to override the program's decisions and extract additional...
- 4
- 496
- 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGCCCTTCCGGAGAAGA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAAGCTGCACCTCCTGATCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT ... GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT GCGCGGATCCACCATGGCACTTAACCCATG CGCGCCTCGAGTTATGGAGTTGAACTAGCTGT GCGCGGATCCACCATGTCCTTGAGGGACACA CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT Length (bp/amino acids) 576/192 ... excised and purified with the GFXTM PCR DNA and Gel Band Purification Kit (AmershamPharmacia Biotech) Each p26 cDNA was ligated into pET21(+) using T4 DNA ligase, and competent E coli DH 5a were transformed...
- 10
- 495
- 0
Báo cáo khoa học: Serine-arginine protein kinases: a small protein kinase family with a large cellular presence potx
... Jobanputra V & Salazar G (2004) The A- type cyclins and the meiotic cell cycle in mammalian male germ cells Int J Androl 27, 192– 199 86 Yang R, Nakamaki T, Lubbert M, Said J, Sakashita A, Freyaldenhoven ... phosphorylation of the RS domain l The exact share the SRPKs hold amongst the other kinases that also recognize RS dipeptides, such as the Clk and Akt family of kinases, as well as the cross-regulation between ... between them l The specific role(s) of each one of the SRPK family members and the significance of the ‘spacer domain’ for the functional properties and the particular regulation of each kinase l The...
- 17
- 375
- 0
Legal Guide for Starting & Running a Small Business ppt
... sues and wins a judgment against the business Only corporate assets are available to pay the damages Andrea is not personally liable Liability for your own acts If Andrea herself had dropped the ... Occasionally, the members of an LLC will conclude that there’s an advantage to being taxed like a having pass-through taxation for your LLC—meaning that the business isn’t taxed as a separate ... forming an LLC E Choosing Between a Corporation and an LLC Let’s assume that you’ve read all the earlier material in this chapter and that you now understand the chief legal, tax and financial characteristics...
- 470
- 984
- 1
Báo cáo khoa học: "a bilingual dictionary generating tool" potx
... human or a machine, expects all translations to be accurate We evaluated 2000 randomly selected Japanese entries from the initial translation candidates, scoring all Hungarian translations as correct ... that pass a global threshold (0.1) are selected as translation pairs Since synonymy information is available for nouns (N), verbs (V), adjectives (A) and adverbs (R), four separate scores are ... dictionary that we generated from the Japanese EDR corpus (Isahara, 2007) to weight each Japanese entry Setting the standard to the frequency dictionary (its recall value being 100), we automatically...
- 4
- 325
- 0
A Small-Scale Agriculture Alternative: Poultry pdf
... guinea fowl are raised for meat markets Some birds are raised for exhibition Mallard ducks, quail, and pheasant are raised for hunting preserves and for dog training Markets are also available for ... avian influenza and other diseases; mixed-species poultry operations can serve as a catalyst for virus mutation and increase the risk for disease outbreaks. A feather or one speck of fecal matter ... surfaces Pine shavings or straw are the best materials for giving meat birds the traction and leg support they need. Feed a totally balanced ration For fryers and broilers, use a starter mash or crumble...
- 6
- 215
- 0
Guide on How to Develop a Small Hydropower Plant pot
... semi-Kaplan siphon Axial Siphon Parallel 6.17 Kaplan S Axial Gate valve Parallel 6.18 Kaplan inclined right angle Axial Gate valve Conical 6.19 Semi-Kaplan in pit Axial Gate valve Parallel 6.20 165 ... its trashrack, the vertical axis Kaplan turbine coupled to the generator, the draft tube and the tailrace The control equipment and the outlet transformers are located in the generator forebay In ... increaser Figure Vertical Kaplan Radial Guide-vanes Parallel 6.14 Vertical semi-Kaplan siphon Radial Siphon Parallel 6.15 Inverse semi-Kaplan siphon Radial Siphon Parallel 6.16 Inclined semi-Kaplan...
- 145
- 400
- 0
Báo cáo khoa học: FH8 – a small EF-hand protein from Fasciola hepatica docx
... FH8 therefore behaves like the Ca2+-loaded states of other EF-hand CaBPs, namely CaM, TnC and calbindin D9K In all of these proteins, the denaturation temperatures of the Ca2+-loaded states are ... modeling of FH8, as this is the only organism for which the X-ray crystallographic structures for the apo (Protein Data Bank: 1QX5) and Ca2+-loaded (Protein Data Bank: 3B32) states are available [38,39] ... dimerization was observed for concentrations of Ca2+ above mm The conformational alterations induced by Ca2+ and, in particular, the sensitivity of the ANS assay were used to assess FH8 affinity for...
- 14
- 356
- 0
Writing a Business Plan: An Example for a Small Premium Winery potx
... of their experiences and January recommendations for a lawyer (3) Send to BATF and SLA for application packets January (4) Hire a lawyer to help with the application process February (5) Have all ... and packaging theme Wineries can choose between sealing wax, newer plastic capsules, and traditional foil capsules Foil capsules are traditional and the standard in premium wine; therefore, the ... Management January/February 1999 Barclay, Veronica “Are You Marketing to the Affluent.” Vineyard and Winery Management January/February 2000 Bizplanit www.bizplanit.com Bureau of Labor and Statistics...
- 49
- 507
- 1
Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx
... the two-step evaluation, common in the machine translation domain and already used for paraphrase evaluation (Bannard and Callison-Burch, 2005) The question asked to the human evaluator for the ... impose the constraint that any transformed part of the source sentence cannot be transformed anymore This paradigm is more approriate for paraphrase generation than the standard SMT approach in ... We propose a variation of the UCT algorithm for paraphrase generation named MCPG for MonteCarlo based Paraphrase Generation The main part of the algorithm is the sampling step An episode of...
- 4
- 338
- 0
Setting up and running a small-scale dairy processing business potx
... of appropriate communication channels and intensify contacts and information exchange (particularly intra-ACP); and develop ACP capacity to generate and manage agricultural information and to formulate ... Lusaka, Zambia Maryline Simba, Simba Foods, PO Box 79360, Ubungo-Maziwa, Dar es Salaam, Tanzania Masoud Rizvi Fidahussein & Co., Vingunguti Industrial Area, PO Box 816, Dar es Salaam, Tanzania ... Chirstabel Malijani, Provincial Health Inspector, PO Box 37136, Lusaka, Zambia Claudia Mary Massawe, Clama Quality Product, PO Box 33496, Dar es Salaam, Tanzania M.T Kaputo, Food Technology Research...
- 188
- 635
- 0
Báo cáo khoa học: Insulin is a kinetic but not a thermodynamic inhibitor of amylin aggregation pot
... insulin may therefore act as an amyloid inhibitor in healthy individuals and a promotional agent of amyloid formation in T2D patients Thus, therapeutic strategies targeting the interaction between ... was incubated with amylin to evaluate its effect on amylin aggregation Samples were incubated at 37 °C for 72 h with shaking, and were taken for ThT assays, light scattering assays and HPLC analysis ... to the inhibition of the early stage of amylin aggregation As the incubation proceeds, increasing amounts of amylin–insulin complex can accumulate and serve as a nucleus for fibrillization of the...
- 7
- 388
- 0
Tìm thêm: xác định các mục tiêu của chương trình khảo sát các chuẩn giảng dạy tiếng nhật từ góc độ lí thuyết và thực tiễn khảo sát chương trình đào tạo của các đơn vị đào tạo tại nhật bản khảo sát chương trình đào tạo gắn với các giáo trình cụ thể xác định thời lượng học về mặt lí thuyết và thực tế tiến hành xây dựng chương trình đào tạo dành cho đối tượng không chuyên ngữ tại việt nam điều tra đối với đối tượng giảng viên và đối tượng quản lí điều tra với đối tượng sinh viên học tiếng nhật không chuyên ngữ1 khảo sát thực tế giảng dạy tiếng nhật không chuyên ngữ tại việt nam nội dung cụ thể cho từng kĩ năng ở từng cấp độ xác định mức độ đáp ứng về văn hoá và chuyên môn trong ct mở máy động cơ rôto dây quấn đặc tuyến tốc độ rôto n fi p2 đặc tuyến dòng điện stato i1 fi p2 sự cần thiết phải đầu tư xây dựng nhà máy thông tin liên lạc và các dịch vụ phần 3 giới thiệu nguyên liệu từ bảng 3 1 ta thấy ngoài hai thành phần chủ yếu và chiếm tỷ lệ cao nhất là tinh bột và cacbonhydrat trong hạt gạo tẻ còn chứa đường cellulose hemicellulose chỉ tiêu chất lượng theo chất lượng phẩm chất sản phẩm khô từ gạo của bộ y tế năm 2008 chỉ tiêu chất lượng 9 tr 25